Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

Unigene SGN-U575161

Unigene Basic Information 
Unigene ID: SGN-U575161
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1485 bp

>SGN-U575161 Tomato 200607 #2 (23 members)
GGCGAAAGGATAATTCATGAACAAAACAGAGGACTTGTGAAATTTCATAGGTCAAAAAGATCAAACTCTAAAACAATTGTCAAGACTCGG
CACCATGTGGAGGAACTCGGTGGGTTTCTCTTCAAAACTCCTCACATCCAAATCTTCATGCAGTCGTCTTCCTTTGCTTAATCATGGCGT
TGCCAGCAGATCCACTTCTACAGCCGCCGGCTCCGGACCGGAGTCTACTGAAGCAGCCGGTACAGTAAAGGTGGGATTTTCATCGACGGA
GTGGGTTCGAACCGGATCTCCGACTTCTTCAGCTGTCGATCTTTCATCTTTTGCGGCTGCATCAGTTTTGAAAGGTAGGGATATTGTGGA
CATGGCTAAGCATTACGGGCGGTGTTATGCGGAGCTTTCTAAAGCTCGCTTAAGCATGCTTGTAGTTGCAACCTCTGGCACTGGGTATAT
CCTTGGGAGTGGTAGTGCCATTGACTACATGGGACTTTGCTGCACATGTGCTGGCACAATGATGGTTGCGGCATCAGCTAGCACATTAAA
TCAGGTGTTTGAGGTGAAAAATGATGCTAAGATGAACAGAACCAAGAAAAGACCATTGCCGTCAGGACGAATCAGTATACCCCATGCAGT
AACATGGGCAGCTTCTATTGGCATCCTGGGCACTGGTTTACTGGCTAGCAAGGCTAATATGTTGGCAGCTGGCCTTGGTGCGTCGAATCT
TGTGTTGTATGCATTTGTATACACACCACTAAAGCAGATACATCCAATTAATACATGGGTCGGCGCAATTGTTGGAGCTATTCCTCCCCT
GCTTGGGTGGGCTGCAGCTTCTGGTCAGGTGTCTCTCAATGGAATGCTCCTCCCAGCTGCTCTGTATTTTTGGCAAATACCTCATTTCAT
GGCCTTAGCCTACTTGTGTCGTAAAGATTATGCTGACGGAGGGTTCAGAATGTACTCTCTTGCTGATGCTTCTGGTCAGAGGACTGCCTC
TGTAGCCTTCAGAAACTGCCTATATCTACTGCCATTGGGTTACCTAGCCTATGATTGGAGTTTAACATCTGGGTGGTTTTGCCTGGAATC
GACACTTCTTGCTCTGGCAATCAGCGGTACAGCAATATCATTCTACTTGAACCGTACAACCAAAGATGCTAGGAGAATGTTCCATGCCAG
CCTTCTGTATCTTCCTGTATTTATGTCTGGGCTTCTAGTTCATCGTGTTACCGAGAGTGAACAGCAAATGACTATTGAACACATGAGTAA
GATTATCGAGCTGTCACCTTCATTGGAAACTGCAGAAGCGGCACAAGAAGAAAAAAGAAAGCAGTCCATAGGAAATGGTCAACGCCGGCC
ACCTGTAGCATATGCCTCGGTTGCTCCATTTCCCTTTCTGCCAGCTCCTTCATATGCTACATTTTAAGTTAATGAACCATTCCTCAATTT
TATTGTCTTACTACTGTAATAAAAATGGGGAAGGGAACTGCCTCT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
Solyc01g080860 Solyc01g080860
Genomic locations (0)None
Library representation (9)  
mRNA member sequences (23)  
Alignment image suppressed for unigene with 23 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (2)  
Annotations (manual: 1 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)