Sol Genomics Network

Unigene SGN-U577630

Unigene Basic Information

Unigene ID:	SGN-U577630
Unigene Build:	Tomato 200607 #2
Date:	2009-03-25
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	none
mRNA sequence:	Length: 827 bp

>SGN-U577630 Tomato 200607 #2 (444 members)
GGGGAAGCACAAATCGTACCATCTTGTAAGTTTGAGAAACGTCTAGTCTAGAGAGAAATGGCAAATCCAAAGGTTTTCTTTGACCTTACC
ATCGGTGGTGCACCAGCTGGTCGTGTGGTGATGGAGCTCTTCGCCGATACCACTCCCAAAACCGCTGAGAACTTCCGAGCTCTTTGTACC
GGTGAGAAAGGTGTTGGAAAGATGGGGAAGCCTTTGCACTACAAGGGCTCAACCTTCCACCGTGTGATCCCAGGGTTCATGTGTCAAGGA
GGTGATTTCACCGCCGGAAACGGGACCGGAGGAGAGTCGATCTATGGAGCCAAATTCAACGATGAGAACTTCGTTAAGAAGCACACCGGC
CCTGGAATCCTCTCCATGGCTAATGCTGGACCTGGAACCAACGGTTCTCAGTTTTTCATCTGTACCGCTAAGACTGAGTGGCTCAACGGA
AAGCACGTCGTGTTTGGACAAGTTGTTGAAGGCATGGATGTGATTAAGAAGGCAGAGGCTGTTGGATCTAGCTCTGGAAGGTGCTCCAAG
CCTGTGGTTATTGCTGACTGCGGTCAACTCTAGATCTGATGATGATGATGATCTAGTTTTATCAGTCTTTTATGTATTTGAGTCGCCGTT
TTAGGCTTTGTTTTTAATTTCAAACTATCTCTACTGCTTTGGTCGGGTCGTGTCGGGTCGAGTTCTAGGGTTAACCGTAATTGGTTGTTG
TGTTGCTTCTACCAGTTTATGTTTAATCTTAAGACTACAATTAAATAAGATACTCATAGACTTGCTAATGCTAAAATCGATTTTGTTGCT
TAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (3)

Locus symbol	Locus name	Gene activity
cyp	cyclophilin	rotamase
Solyc01g110700	Solyc01g110700
Solyc01g111180	Solyc01g111180

Genomic locations (0)

None

Library representation (45)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPT	leaf trichomes 4-8 weeks old	2729	4
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	4
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	30
Solanum lycopersicum	FC	Fruit Mixture of mature green, light green, breaker, turning, light red, and red ripe stages	8046	9
Solanum lycopersicum	LB	Leaf Mature leaves	3316	6
Solanum lycopersicum	LC	Leaf Mature leaves	5712	3
Solanum lycopersicum	LE08	Fruit 8 days post anthesis	339	1
Solanum lycopersicum	LeMiToFr02	fruit	18697	1
Solanum lycopersicum	LeMiToLf01	leaf	30679	10
Solanum lycopersicum	LeTransC5	Root 1.5-month old plants	561	2
Solanum lycopersicum	LeTrich01	Isolated leaf trichomes Apical internodes of 5-week old plants.	7299	11
Solanum lycopersicum	Sl_LeafInf01	Developmental stage	125	3
Solanum lycopersicum	Sl_LeafWT01	leaf 1.5-month old plants	106	1
Solanum lycopersicum	Sl_RootGC02	root Developing giant cell	141	2
Solanum lycopersicum	Sl_RootInf02	root and collar Three weeks old	333	1
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	59
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	4
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	7
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	3
Solanum lycopersicum	cLEE	seeds and maturing carpels 5 days post-anthesis to fruit over-ripe stage	547	1
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	3
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	7
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	4
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	70
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	5
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	1
Solanum lycopersicum	cLER	leaf 4 weeks	5127	7
Solanum lycopersicum	cLES	leaf 4 weeks	5243	15
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	34
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	3
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	3
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	8
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	7
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	14
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	10
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	9
Solanum lycopersicum	cTOD	flowers anthesis-stage flowers from full grown plants	5642	2
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	4
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	11
Solanum lycopersicum	cTOS	suspension cultures	8026	10
Solanum lycopersicum	cTSB	seed	1880	4
Solanum lycopersicum	cTSC	seed	2256	7
Solanum lycopersicum	cTSD	seed	1504	2
Solanum lycopersicum	vSlycmRNA		8362	4
Solanum habrochaites	LH_Ea	Glandular Trichomes	3840	38

mRNA member sequences (444)

To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]

Markers Information (0)

Expression Data (56)

Annotations (manual: 29 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (0)

None

Preceding Unigenes (5)

Unigene	Build
SGN-U314547	Tomato 200607 #1
SGN-U314548	Tomato 200607 #1
SGN-U338797	Tomato 200607 #1
SGN-U338800	Tomato 200607 #1
SGN-U338801	Tomato 200607 #1

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer