Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

Unigene SGN-U577663

Unigene Basic Information 
Unigene ID: SGN-U577663
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1139 bp

>SGN-U577663 Tomato 200607 #2 (21 members)
CAATTATCTCGATATTCCTTCCATCTCAGTTTATATTTTAGTTAAATAATTTCTTGTACTACATATTTTTAATTACTAACAATATTGAAT
TGTTAGCAAGTATTTAAAATTTTCAAATATATTTTTATTTTAAAGAATTAAGTATTTTAACCTTTGTACTACGTCATCGTATAAATTCAG
ACGCAAGAAATACTAGTAATACATAAGGTGTAGGAAGAGAAAGATTTCCTCTATCTCCTTCATTTTTTTACTAAAAAAAAAAGAAGTTGC
TAGTGAGTTAGGCCTATATAGTGTGTTACTTTTTGGTTCTTCACAATATTTTTCTCTATTTCCTCTATTGTGTTTTATGTAAAAATGGCT
GGTATGCTACCTGGTGTTGAATGTGCTAGAAGAAGGAGATTTCATCAAAGTAATGGATGTATAGATTCATCAAACACCTCTAGTTTTTCA
TCCACAAGAAGGTCTTCTTTTTGTCTATACACTAGTAATCATGAACACCACCTCAATTCAAGTTCATCCAAGCAAAGGGGTGTAATAAGT
CAAGCATATCAAGATGAGAAACTAGGTGAAGCTGTAAGAGAAGCCAAGCAAAGGTTGGATGAGAGGCTTAGTGCAAGATGGAAATCACAA
AATAAGAGGGGTCTCAACAATAGACAAAAACCAAACCAAAACCAAGAGATGGTGGAGAATAGGCCAAATTTGCAAGGAGAAGTATTTTCA
GGACTAAAGAGAAGTGGATCAAAGAAGTTTAATTGGGCAAAAATGATTTGGAAATCTCAAGAACAGGATGAATGTTCAATTTGCTTGGAT
CAATTCAAGATTAGTGATAACTTAATGCAATTGACATGTGCCCACAAATTCCATTCCAAGTGTTTGGTGCCATGGCTAGAATTCAATGCA
CATTGTCCATGTTGTAGAATGACAATAATATTGACTAGTACTAGTGCATAATTAGGAAAATGGAAGGAAGTTGCATATGTCTTTTTCTAC
AACTTGTAGGTGTCCAAGATTTTCTAAAATGTACAAAATTATATATATAGAGAGAGATATAATAGGTGTCTTGTAATTGAATCTATTGAC
TATTTTTTTATCGTATAAGAAAAAACTTTTATGAAGTTTGAGATATGGTGGATGGGAGA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (4)  
mRNA member sequences (21)  
Alignment image suppressed for unigene with 21 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (7)  
Annotations (manual: 2 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)