Unigene SGN-U578301

Unigene Basic Information 
Unigene ID: SGN-U578301
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1906 bp

>SGN-U578301 Tomato 200607 #2 (34 members)
CCGAGTACGACAGCGTATTGACCCGCATTGTAATTTGTAAGTCCGTTTGGGGTCAAAATAATCGAAATCGGGGCTATAGTAGTAGTAGTA
AATACACAAGAGTCTCATCTTTCTAATCTATTCTTCTTTACTGAACTCCTGCGGCGTAGATCCGAGGAGTTTCAGACAAAAAACCCTAAC
CCCCAATCGCTTCTCTTTCCCTCAGATCTTTTACTCTTCTTTATCAGTCATGGCTGGCTTGGCACCGGAAGGTTCTCAATTTGATGCTCG
TCAATTTGATGCTAAAATGACAGAGCTGCTTGGGACTGAACAGCAGGAGTTCTTTACATCATATGATGAAGTTCATGACAGTTTCGATGC
CATGGGTTTGCAAGAAAATCTTCTTAGGGGCATCTATGCCTATGGTTTTGAGAAGCCATCTGCTATCCAGCAAAGGGGTATTGTTCCTTT
TTGCAAGGGTCTTGATGTGATTCAACAGGCACAATCTGGTACAGGAAAGACAGCAACTTTCTGCTCTGGGATTCTCCAGCAGCTTGATTA
CAGCTTAGTCGAATGTCAGGCTCTGGTTCTGGCTCCAACCCGTGAGCTTGCCCAACAGATTGAGAAGGTTATGCGAGCACTTGGTGACTA
TCTTGGTGTGAAGGTTCATGCCTGTGTAGGAGGTACCAGTGTCCGTGAGGATCAGCGTATCCTTCAAAGTGGTGTTCATGTGGTTGTTGG
TACTCCTGGTCGTGTATTTGATATGTTGCGTAGGCAGTCTCTTCGCCCTGACCACATCAAGATGTTTGTTCTGGATGAAGCTGATGAAAT
GCTCTCAAGAGGTTTCAAGGATCAGATTTATGATATTTTCCAATTGCTGCCACCAAAGATTCAAGTTGGTGTTTTCTCTGCTACAATGCC
ACCAGAGGCTCTTGAAATTACTAGGAAGTTCATGAACAAGCCTGTGAGGATCCTTGTGAAGCGTGATGAGCTCACTCTTGAAGGTATCAA
GCAATTTTATGTCAATGTTGACAAGGAAGAGTGGAAGCTTGAAACTCTTTGCGATCTTTACGAGACCTTAGCCATCACCCAGAGTGTCAT
CTTTGTGAACACCAGGCGCAAGGTTGATTGGCTCACTGATAAGATGCGCAGCCGTGATCACACAGTATCTGCCACTCATGGAGACATGGA
CCAGAACACTAGAGATATCATTATGCGAGAGTTCCGATCTGGATCATCTCGTGTGCTCATCACTACTGATCTTCTGGCACGTGGTATTGA
TGTGCAGCAAGTATCCCTTGTGATTAACTATGACCTGCCTACTCAGCCAGAAAACTACTTGCATCGTATTGGTCGTAGTGGACGATTTGG
AAGGAAGGGTGTAGCTATCAATTTTGTCACAAAGGATGATGAAAGGATGCTTTTTGACATTCAGAAGTTTTACAATGTTGTAGTTGAGGA
GCTGCCAGCCAATGTGGCCGATCTTCTTTGAGGTGATTTTGGTTCTGTGAGGTGAATTTTTCGTTATATTAAGTAATTTAATATTTTATT
GTTAGGTTAGTTAGAGCCGCAGTGGACTAAAACTTGGAAACTGCAGTTTCTGTGATTCGCCGTGGGAATTGTAGTTTTCCAATTTAGTTG
GACTTATTTACAAATTTTGTTGGTTTTGTCTTTTTGTATTGTAAGTCCACAACAACTTCAGGTTTTGGATGTCTTTGAATTTAGTATATT
TCATTTTAATCCTTGGCCTTTTTTCTTCTTCTTTTTTTTTCGTTTTGTTGTATGGGAACGCTTTTGACGACAATATGTTCGTTCATCTGT
ATTGTGTGATAGTTTCTGTTTGTGATGCCTTGTATAGGTTTTTTTTTCCTGTGTTGATGACTTGTATCATACTTGGAACTTGAATTGGAT
AATATTTTTATCAGCT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (20)  
mRNA member sequences (34)  
Alignment image suppressed for unigene with 34 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (1)  
Annotations (manual: 2 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (2)