Unigene SGN-U578588

Unigene Basic Information 
Unigene ID: SGN-U578588
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1153 bp

>SGN-U578588 Tomato 200607 #2 (40 members)
GCCAACTTTGTGTAACCCTTTTTACACAAATCATAAGGATAACTCATGGCCGCCACTGCCTCTGCTAATTCACTCACATCTGCTTTTCTT
CCTCCTCAAGGATTTAATGGATCATCTAAGAGCTTACAATGGAGAACCCAAAAGAAACAATTTGGAAGAAAAGCTGGCTCTGCTACAATA
ACAGCTAAATTTGACCTCATCCCTCCTCCTTATCCAATGGATGCTTTGGAGCCTCATATGAGTAGTAGAACATTTGAATTCCACTGGGGG
AAGCATCACAGGGCGTATGTCGACAACTTAAACAAGCAAATTGATGGAACAGAATTAGATGGAAAGACACTAGAAGATATAATACTTGTT
ACATATAACAATGGTGCTCCCCTTCCAGCATTCAACAATGCTGCTCAGGCCTGGAATCATCAGTTCTTCTGGGAATCTATGAAGCCCAAC
GGAGGAGGAGAGCCATCCGGTGAATTATTAGAACTAATAAATAGAGACTTTGGTTCCTATGATACATTTGTTAAAGAATTTAAGGCAGCT
GCAGCAACACAATTTGGCTCCGGATGGGCCTGGCTTGCATACAAACCTGAAGACAAAAAGCTTGCTCTAGTGAAAACTCCTAATGCTGAA
AATCCTCTTGTTTTGGGATACACACCACTCCTCACCATCGACGTTTGGGAGCATGCTTACTATCTGGACTTTCAGAATCGGCGACCTGAC
TACATATCTATCTTTATGGAGAAGTTGGTGTCATGGGAAGCAGTCAGTATTAGGCTTAAAGCAGCATCAGCTTGAGGTAAAATAGAAAGG
GTTAAGAGGCAAATATAATGTACACTGAGTACATACTTGAGGCAGAATGTTTTTTTGTCAATGAGACATTATGTTGATGTTGTTTATGTA
GTTGATGGACAGGAAAAATAAATGATGCAAGAAGTTTGAGTAAAAAAAAAAAAAAAAAACTCGAGGTAGCCGAGGACTTGGCAAGATTAA
AAGGGCTTTCTTGGGTAGTGTGAGCGACTATTGTGCTCATCATGTGCAATGTCCTATTCTCATTGTGAAGCCACCCAAGGAAAACCCCAA
AAGCAGCTAATTAACAAGGATATATCATGTGCCAGTCTATGAACAATGTCATTTACTTGATGATGAATAAACA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
fesod iron superoxide dismutaseiron superoxide dismutase
Genomic locations (0)None
Library representation (17)  
mRNA member sequences (40)  
Alignment image suppressed for unigene with 40 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (1)  
Annotations (manual: 1 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)