Unigene SGN-U578921

Unigene Basic Information 
Unigene ID: SGN-U578921
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1285 bp

>SGN-U578921 Tomato 200607 #2 (21 members)
CTTTTAAGTTGTCCTATAAATACCACACAACTTTGAGAATGTAGTCCGTTGAAGGTGTCTGATGTGTATAAACAAAGTTAAAAGGTGTTC
GTGAGGTGCACCTATGTAAGTAGAAGAGTTCATGAAAAAAATTACACCATATATAGATAGCTTAATATCCTAGTTGAAAATATTATTTAT
TCAAAAATAGTGTATGTCTTTTGATGAGTCTTGGCATTTAAGTTGTTCTGTCTGTACTTTTTTTTGTTTTTTGTCCCCCTCCTTTTTCCT
TAACCATTTGGAATCACCATTGAAGAAGAGATGGAGATTGCCTAGAAATGTTCTTCTTTTTTTTTTTAACTTCTTAATTTTTGAATCTGC
CGACAATGATGATATGGACAGAAAAAATTTGGTTAATTCTATTTTTTAAAGATTGTTCTCAGAGGCAGCATTCATACTTTTTATGGACAG
GTACCTGTAAAAGTTTTTTACATTGTCAGTGTATAGTAGTTAAATTCTTCTCTATATCGAGAAATATTTTGTCAACCCTTTTCATTAGTG
AACTTGTTGCGACTTAGGTTCTTCAAGAATTCACACATGGAAAGCAAGAGAAAGTAAGCAAGACTGAGTTTAAAGAAGTTCTTTCAGATA
TTTTACTAGGAATGGCTGCTGGTCTAAAGCGAGATCCTATTGTACTCCTTCGTATGGATGGTGAAGATCTTCTTGAGTTCGTTAAAAGTC
CTGCATTCGAACCAGAGATGATTTCCCTGTACTCTGAGTTAGAATTGCCTGATGGATCCCTCAAAGATTACATCATCAAGGCTTTTGAGA
AGCTCACGGTTGATCAAGGGATGCCTCCTGCATCAGACTCATGGGTAGTTCATTTTTCTCTTTGATGGCTTAACATTCATGTCTAGCTAG
AAATTTTACTCTAGAAGATTACATAAATTTGGTTACTTGCAAGACATGACAAATTAACGGTTACAAGTATAGTCTTTTAAAATGTGATTG
CTCACTGATTCGTAAAATTTGTTGCTTACAATCCTGTGTAACTTCTTTGTTACACATTTATTTTTATGATGAGTTCTTTTCTAATTATTA
GAGCATATTACTTTGTTATTATCTTGATCTGTAGGTAATGAGTAATGTTGTGGAGCCAGTAGTTGAATCCTGCATTGGAGCAACTAACGA
GCAACCTGTTACACAAGAAACATTTTTGGCTGAATTTAAGAAAGTTGCAGAGAGTGCTGCTCAACGTCTCAAGGAGCAGCCAGTCATTGT
TGCTCACAGCGAGAATACATTTGAT


[Blast] [AA Translation]
Associated Loci (3)  
Locus symbolLocus nameGene activity
Solyc01g110700 Solyc01g110700
Solyc01g111080 Solyc01g111080
Solyc01g111180 Solyc01g111180
Genomic locations (0)None
Library representation (7)  
mRNA member sequences (21)  
Alignment image suppressed for unigene with 21 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (6)  
Annotations (manual: 1 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)