Unigene SGN-U578947

Unigene Basic Information 
Unigene ID: SGN-U578947
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 779 bp

>SGN-U578947 Tomato 200607 #2 (200 members)
AAGTCAATGGCCACCATGAAGTTGAGTTAATAGCCAAACGCCAAGTAATCAAGGAAATGTATACTGTATTTTCTCAGAATAGCTTTCCAC
GAAAAGTTGGCTCTTTAGAACCTTGTTTTACGGCCGGGGATCCCTCAATTTTCATATTTCATTAGTACGAAGTTTTGAACAAAAAAATAA
TAATTAAGAATGGGTTCCAAGGCAATTTTGTTTCTTGGTCTTTTTTTGGCTATTTTCTTAATGATAAGCTCTGAGGTTGCAGCTAGGGAG
TTGGCAGCTGAGACTACCAATGCGGTGAAATTGGATAACGAGAATGCAGTAAACGTCGATCATTATTATGGCAAGGGCTATGGCAAACGT
AAGAAATGTTACAGTTGCTGCAAAAAATACAAATATGGATGCAAAAAATACTGCTGCTCTTATGAAGAATATGTTGCTGCCCAGACTCAA
AACTAAATAATTAATTAGTGCTTAATTATGTGTATTTATTATTATTGTAAACTTTTGAAATTAAGTGACAAGATAATAATAATCTTGCTA
CTTAATTAAGACCCTTTGCTTGTAACAAGTATGAATAAAGCCATTCATTTACGTACTATGAATGGTTGGTCATGATGTAATGTTTTGTTG
TACAATATATATCATATTGTGTTTAAAAATGTTTCCATAACGTTTTATCTGAAGTTTTCTGGGGCCTTCTCCTTCATTTTCTCGAATTCC
TCCTTGTAAAGTAGTGAGCTGCTGGTGGGAACACCCAAGAAAAACCATGCTTGTACCTC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
X77373 cell wall protein X77373
Genomic locations (0)None
Library representation (20)  
mRNA member sequences (200)  
Alignment image suppressed for unigene with 200 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (15)  
Annotations (manual: 3 | blast: 0 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (2)