Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

Unigene SGN-U579490

Unigene Basic Information 
Unigene ID: SGN-U579490
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 2809 bp

>SGN-U579490 Tomato 200607 #2 (23 members)
GGGGGCTAGTGCAGTACCGGGGGCTGCTTACGATGTGAAGATAGGAGAAAACGTGGGTACTTCAGGTTCCACATCTTCTCCAAAAATCTT
CCCTTTTCGTGGGGTCTGTAGCTTTGTTCCTCCTCCACCACAAATCCCTTCTCCTCCCCAAAAATAGTAATAAAGTTATAAAGCAAAAAA
GGGTAGAAAAGCCCCATTTCATTTCTTCAAGTTGACGCTTGATTCACTGATGAACAGTCAAGAACTTGTTTGGGGTTGAAGTATAGTTGA
TTCTTGAAAATACCCAATTTGCAAAAACTTGTTTTGGGTTGAGGGGTAGTTGATTCTTGAAAAATACCCAATTTGCTAAGAACTTGTTTG
GGGTTGAGGGGTAGTTGATTATTGAAAAATACCCAATTTTGCTAAAAAGTTGTTTGGGGTTGAGGGGTAGTTGATTATTGAAAAATACCC
AATTTGCAGTTGGGGGTATAGAGGGAGATGGTGGAAAGTTCAGTTGGAGGGGTGGTGCCAGCAGTGAAGGGGGAGGTGATGAGGAGGATG
GGGGACAAAGAGGAGGGGGGTAGTGTAACTCTAAGGGATGAAGAAGTTGGGACAGTGACAGAATGGGAATTGGACAGGGAATTGTTGTGT
CCTATATGTATGCAGATCATAAAGGATGCATTTTTAACAGCTTGTGGGCACAGTTTTTGCTATATGTGCATAGTTACTCATCTTCACAAC
AAGAGTGATTGCCCCTGTTGTTCTCATTATCTCACTACCAGTCAACTCTATCCCAATTTCCTACTTGACAAGCTATTGAAGAAGACATCT
GCCCGTCAGATTTCAAAAACTGCATCCCCTGTTGAACAGTTTCGTCATTCATTGGAACAGACAGGGTTCTGAAGTGTCAATTAAGGAGCT
GGACGCTCTATTGTTGATGTTGTCAGAGAAAAAGAGGAAATTGGAACAGGAGGAAGCAGAGCGAAATATGCAAATTCTGCTAGACTTCTT
ACAGATGTTAAGGAAGCAAAAAGTTGATGAACTCAATGAGGTGCAACATGATCTGCAATACATCAAAGAGGACTTAAATTCAGTAGAGAG
ACATAGAATAGACCTATACCGGGCTAGGGACCGGTATTCAATGAAGCTCCGAATGTTAGCAGATGATCCTATTGGGAAAAAACCTTGGTC
TTCATCAACTGATAGGAACTTTGGTGGTCTTTTCTCCACTTCACGAAATGCACCTGGAGGATTACCGACTGGAAACTTGACATTCAAAAA
GGTGGACAGCAAAGCTCAAATAAGCTCTCCTGGACCACAGAGAAAAGATACTTCAATCAGTGAACTGAACTCACAACATATGAGTCAATC
AGGTCTGGCTGTGGTTAGGAAGAAGCGTGTCAATGCACAGTTCAATGATCTCCAAGAATGTTACTTGCAAAAGAGACGTCAATTGGCAAA
CAAATCGCGAGTTAAGGAAGAAAAGGATGCAGATGTCGTACAAAGAGAAGGTTACAGTGAAGGACTAGCAGATTTTCAGTCTGTACTTAG
CACTTTCACTCGTTATAGTCGGTTAAGAGTCATTGCTGAACTTCGGCATGGGGATCTGTTTCACTCGGCCAATATTGTTTCAAGCATTGA
ATTTGATCGGGATGATGAGTTGTTTGCTACTGCTGGAGTTTCACGGCGTATAAAAGTTTTTGACTTCTCTTCAGTTGTAAATGAACCTGC
AGATGCACACTGCCCTGTTGTTGAAATGTCTACCCGATCTAAGCTGAGCTGCTTGAGTTGGAATAAGTATACCAAGAACCACATAGCTAG
TAGTGATTATGATGGAATAGTAACTGTATGGGATGTGACGACTAGACAGAGTGTGATGGAATATGAAGAGCATGAGAAACGGGCTTGGAG
TGTTGATTTTTCACGCACAGAACCCTCGATGCTTGTATCTGGCAGTGATGATTGTAAGGTCAAAGTTTGGTGCACGAAGCAGGAAGCAAG
TGTTCTTAATATTGACATGAAGGCAAATATATGCTGTGTAAAATATAATCCTGGATCTAGTGTTCATATAGCGGTTGGCTCTGCGGATCA
TCATATTCATTATTATGACTTGAGGAACACCAGCCAGCCGGTTCACATTTTTAGTGGCCATAGAAAAGCTGTTTCATATGTAAAATTTTT
GTCCAACAATGAACTTGCTTCAGCATCAACAGACAGTACTCTACGATTGTGGGATGTAAAAGATAATTTGCCGGTTCGCACGCTTAGAGG
ACATACGAATGAGAAGAACTTTGTTGGTCTCTCAGTGAACAATGAATTCCTGTCATGTGGCAGTGAAACAAATGAAGTATTCGTGTACCA
TAAGGCGATATCCAAACCCGTGACTTGGCATAGATTTGGTTCCCCAGACATAGACGAAGCGGATGAAGATGCAGGATCTTATTTCATCAG
CGCAGTGTGCTGGAAGAGCGATAGCCCTACGATGCTAGCTGCTAATAGCCAGGGAACTATAAAAGTGTTAGTCCTTGCAGCTTGATGAAG
TTAATAAAGCTACTAGTTAAGAATGTTCAAATCTTTTTAGTGGAAAAACAGTGAAATGGAATTTCACATTCAATTTTTCCTGTAGATATC
TATTCAACCATCAAGATGGCATGGTTCCCCCCATATTTGTCAATGTATTCATCATTAAAACATGTAACACAAGTTGTAGGGCTTGGTAAA
TTTAGAAGAATTTTACAAGTTTGTGTTTTTTTTTTTCATTGTGCTGAAGGACATCGGATTTACACACCATTTCATGGAATAAACTTTACT
CGTATTCAGTGTTTACACC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
cop1 COP1 homologE3 ubiquitin ligase
Genomic locations (0)None
Library representation (12)  
mRNA member sequences (23)  
Alignment image suppressed for unigene with 23 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (5)  
Annotations (manual: 3 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)