Unigene SGN-U579706

Unigene Basic Information 
Unigene ID: SGN-U579706
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1680 bp

>SGN-U579706 Tomato 200607 #2 (21 members)
GGCTATATTTTACCCTTCTAACCCATTGTTAGCAAATTCCGTAAAACACCTTCTCACACAGAGAACCCAATCTCCGCCTCCGGCCACACT
CTTAATTTATCGTCCTAGGGTTTTCAGTCGCCGGAAAAGAAATTCGATTTTCCGACGAATCTATCGAGGTGATTGAGGATTTGGATGAGA
ATACAAGATGCCGCCAAAGCAATCTAAAGCCGATATTGCAAAGAAGCAGAAGGTAGTTGAAGACAAGACGTTCGGTCTTAAGAATAAGAA
CAAGTCGAAGAATGTTCAGAAATATGTTCAGTCTTTACAGCAAAATGTTGTGCCTAAAGCTGATCCTAAGAAACTTGACGCCAAGAAAAA
GAAGGAAGAAGAGAAAGCTAGAGAGAAAGAGCTTAGCGAATTGTTCAAAGTCGCTATTAACCAACCTAAAGTGCCTCTAGGTGTTGATCC
AAAATCTATTTTATGTGAGTTCTTTAAGGCGGGGCAATGTGTTAAGGGTTTTAAGTGCAAGTTCTCTCACGATCTGAATGTTCAGCGAAA
AGGAGAGAAGATTGATATTTTCAGCGATAAGCGTGATGAAGATGGAAAGGAAACAATGGACGATTGGGATCAAGAGACACTGGAGAAGGT
TGTGGCGTCAAAAAGTCAAGAGTATAACAAGAACAAACCAACTGACATTGTATGTAAATTCTTTTTGGATGCGGTGGAGAAAAAGCAGTA
CGGTTGGTTCTGGGCCTGTCCAAATGGTAAAGAATGCCATTACAGGCATGCACTTCCTCCTGGATATATTCTCAAGTCACAAATGAAAGC
CTTGTTACAAGAGGAAGCTGACAAGATGCCTATTGAAGAAGAAATTGATCAACAGCGTGCAAAATTGACTGCTTCAACTCCCTTGACCAC
TGAATTATTTATGGAATGGAAAAAAAAGAAGACGGAAGAAAGAGAGGCCAATTTGGCCAAACAGAGGGCAGATAGAGCTAAGAATGATCG
CATGAGTGGTCGTGAGTTGTTCATGTCGGATGCTAGTTGGTTTGTGGATGATGTGGGGGCCTATGACAAGTATGATAGGGAAGAAGAGTC
TGCTGAACTCCCAAAGGAGAATAAGGATTCTGCTAGGGAAGAGGCAAGCTCCTCGACATCAGCCCAGAAGAATATTCATGATGGTGGTGA
GGCTTCACATAAAGACCAAGTGGATGACATTTATGACGACGACGATGATGATGATGACTTTGATGTGGATGAGTTAAATGAACTGGAAGC
TAGCCTTTCAAAAACATCGTTACAAATCAATGAACCTGGTAGTCGCGCTTGATCCTTGGGCCCAAAATCTATGCACATGGTATACACTTA
TCAGTGCATGCACTTTCATGTCTACGTGATGCAAAATCATGTTGGCGTGCAGCAGCAGATAAAATGGAATGAAATGTAAGCATATCCCTG
TCGTGACGCCTTAATAATTGATCCTCTATTTTATTAGGTTTTTACCCTTATTTCTAATGAGTTGTGACTTCTTTCTTTCCAGAATTTTTG
ATGAATTTAACTTGTCTGGTTGTTTTGCTGTCACATAAGAGAGCTATCCTTTGTATTTTACTACTACTACTATGCTTTGAAGTGTGTTGC
CTTCTCATTGCCCTTTATAATGATTCTACTACTATAGGCGTAGTAAAAAACTTTTGATCG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
SlC3H53 Zinc finger transcription factor 53Zinc finger transcription factor
Genomic locations (0)None
Library representation (12)  
mRNA member sequences (21)  
Alignment image suppressed for unigene with 21 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (3)  
Annotations (manual: 2 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)