Unigene SGN-U579974

Unigene Basic Information 
Unigene ID: SGN-U579974
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1500 bp

>SGN-U579974 Tomato 200607 #2 (24 members)
CCGAATTGACTGTGTTGATTTTCACAAAATTTTAGTATTTTCTTCTTATCCACATTCAATAATATTCACAAAAAATGAAACTACACAAAT
TCACCTAAAAATTGAAATCAACAACAAAAAAAAATCAAATCTTGAAAACCCCCTTTTAGATAGAAGAGCAAAAAAATCAAATCTTGATTT
GCCCCTTTTTGTGTTATTGTTGTTTTTAGATAAAAGAGCAAAAAAAATCAAATCTTGAAAACCCCTTTTCTGTTCTAATGGGTAAAGGAG
GCAGTGATGAAAATATGGCTGCTTGGCTTCTTGGTGTTAACACCCTCAAGATTCAGCCTTTCAATCTCCCTGCTTTGGGACCCCATGATG
TTAGAGTTAGGATGAAGGCTGTCGGTATTTGTGGAAGTGATGTTCATTACCTCAAGACCATGAGGTGTGCGGATTTTGTGGTTAAAGAAC
CAATGGTGATTGGGCATGAATGTGCCGGGATCATAGAGGAAGTTGGCGGTGAAGTCAAGACATTGGTTCCTGGAGATCGTGTAGCACTAG
AGCCCGGAATTAGTTGTTGGAGATGTAATCTTTGCAAAGAAGGGCGATATAATCTCTGCCCCGAGATGAAGTTCTTTGCTACTCCCCCTG
TTCATGGTTCTCTTGCGAATCAGGTAGTCCACCCTGCAGACCTATGTTTCAAGCTCCCGGATGATATAAGTTTAGAGGAGGGAGCAATGT
GTGAGCCACTTAGTGTTGGTGTTCATGCCTGTCGGCGTGCAAATGTTGGTCCTGAGACAAACATATTAGTGCTGGGAGCTGGACCAATTG
GGCTTGTCACGCTGCTTGCTGCTCGTGCTTTTGGTGCCCCAAGAATTGTTATTGTGGATGTAGATGACTATCGTCTTTCTGTTGCAAAGA
AGTTAGGAGCAGATGACATCGTCAAGGTTTCAATCAATATTCAGGATGTAGCTACAGATATAGAAAACATTCAGAAAGCAATGGGAGGTG
GAATCGACGCGAGTTTTGACTGTGCTGGCTTTAACAAAACTATGTCGACCGCTCTTGGTGCAACTCGTCCAGGTGGCAAAGTTTGCTTGG
TTGGAATGGGACATCATGAGATGACCGTTCCTCTCACTCCAGCTGCTGCAAGGGAGGTCGACGTCATCGGCATATTTCGCTACAAGAATA
CATGGCCATTGTGTCTTGAGTTCTTAAGAAGTGGTAAGATTGATGTGAAACCTTTGATCACACACAGGTTTGGATTCTCTCAAGAAGAAG
TTGAAGAAGCTTTTGAAACAAGTGCTCGTGGTGGTGATGCTATTAAAGTCATGTTTAATTTGTAAAAAAAAAAAATACTTTTTAAATTTG
AGAAAATAAGTTTTTTTTTTTACCAAATATGTTTGTAAAATGTATATCTAAAAAAAATGTTTTTTTAATGCTTTTGAAAACTACTATGTA
TTAATATAAAATGGTGAAATGAAGTAGATGGTTAACTTATTTCTGTAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
sdh sorbitol related enzymesorbitol related enzyme
Genomic locations (0)None
Library representation (13)  
mRNA member sequences (24)  
Alignment image suppressed for unigene with 24 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (1)  
Annotations (manual: 0 | blast: 3 | go: 4 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)