Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Unigene SGN-U580510

Unigene Basic Information 
Unigene ID: SGN-U580510
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 570 bp

>SGN-U580510 Tomato 200607 #2 (4 members)
AACCAAAGCCCCCCCCCCCATCTATACCAATATTTAAACCTCTTTACCAAACAACAACTACTAAACTAAGGATACCCAAAAAGTCCATTC
CATTAAAAATCTATTAATACATGGGAAAATTTTACAAGGGGTTTTTGGCTAAAATACTAAATGAAAAAAAATACAATTTAATTAGGGAAA
ATGCCTTTAGGGAAAAAAACATCCCCAATGTTGTTGTGCCATGGGTCACCCAAATGAATTGCCAAATTCCCCAATGGTCCTGTTCCTGGA
AATGCTAATTGTTGTACACAAAATCCCACAAATGCCAACAATGCAAAAAAACCATTCTTGATTTCCTTGACTTTAAATTCCTCAAATTTA
ACAGGGTCTTTAAAATAACCCAATGGGTCAAAAACCCCCCCAGGGTACTTCTTCTTTTCTAAATCGTTTTCCAAACCCCTTTGGTGTTCC
ACAAAACCCATGGCTAAAAATTCAATAACCAAAATAATAAGAATTTTTCCCCATGGAACAGGCTGGCCCCAAAATTTACCTTTTCCCCCA
AAAAAGGCTGCCCCTTCTTGGGCCTTGACC


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (4)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (4)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (0)None