Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

Unigene SGN-U580527

Unigene Basic Information 
Unigene ID: SGN-U580527
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1939 bp

>SGN-U580527 Tomato 200607 #2 (240 members)
GAACAAATTGCATTCTCCATTCTTGGAAGTGGCCATTCTTGATTTCTTGAAACAAAGTGTTTTTGTTATATACAGGGGGTGGAGTTAGAG
GGTAAGTTACGCATTTAGTCGTAACTTTAGTCAAACTTCGTAATAATTAGAAATTCAGAGTGGCCATTGTTGAAAGAGAGGGTGGAATTT
GTAAGTCAAGAAACAGGTTACTCCTGTTTGAGTGAGGAAAAGTTGGTTTGCCTGTCTGTGGTCTTTTTATAATCTTTTTCTACAGAAGAG
AAAGTGGGTAATTTTGTTTGAGAGTGGAAATATTCTCTAGTGGGAATCTACTAGGAGTAATTTATTTTCTATAAACTAAGTAAAGTTTGG
AAGGTGACAAAAAGAAAGACAAAAATCTTGGAATTGTTTTAGACAACCAAGGTTTTCTTGCTCAGAATGTCTGTTGCCTTGTTATGGGTT
GTTTCTCCTTGTGACGTCTCAAATGGGACAAGTTTCATGGAATCAGTCCGGGAGGGAAACCGTTTTTTTGATTCATCGAGGCATAGGAAT
TTGGTGTCCAATGAGAGAATCAATAGAGGTGGTGGAAAGCAAACTAATAATGGACGGAAATTTTCTGTACGGTCTGCTATTTTGGCTACT
CCATCTGGAGAACGGACGATGACATCGGAACAGATGGTCTATGATGTGGTTTTGAGGCAGGCAGCCTTGGTGAAGAGGCAACTGAGATCT
ACCAATGAGTTAGAAGTGAAGCCGGATATACCTATTCCGGGGAATTTGGGCTTGTTGAGTGAAGCATATGATAGGTGTGGTGAAGTATGT
GCAGAGTATGCAAAGACGTTTAACTTAGGAACTATGCTAATGACTCCCGAGAGAAGAAGGGCTATCTGGGCAATATATGTATGGTGCAGA
AGAACAGATGAACTTGTTGATGGCCCAAACGCATCATATATTACCCCGGCAGCCTTAGATAGGTGGGAAAATAGGCTAGAAGATGTTTTC
AATGGGCGGCCATTTGACATGCTCGATGGTGCTTTGTCCGATACAGTTTCTAACTTTCCAGTTGATATTCAGCCATTCAGAGATATGATT
GAAGGAATGCGTATGGACTTGAGAAAATCGAGATACAAAAACTTCGACGAACTATACCTTTATTGTTATTATGTTGCTGGTACGGTTGGG
TTGATGAGTGTTCCAATTATGGGTATCGCCCCTGAATCAAAGGCAACAACAGAGAGCGTATATAATGCTGCTTTGGCTCTGGGGATCGCA
AATCAATTAACTAACATACTCAGAGATGTTGGAGAAGATGCCAGAAGAGGAAGAGTCTACTTGCCTCAAGATGAATTAGCACAGGCAGGT
CTATCCGATGAAGATATATTTGCTGGAAGGGTGACCGATAAATGGAGAATCTTTATGAAGAAACAAATACATAGGGCAAGAAAGTTCTTT
GATGAGGCAGAGAAAGGCGTGACAGAATTGAGCTCAGCTAGTAGATTCCCTGTATGGGCATCTTTGGTCTTGTACCGCAAAATACTAGAT
GAGATTGAAGCCAATGACTACAACAACTTCACAAAGAGAGCATATGTGAGCAAATCAAAGAAGTTGATTGCATTACCTATTGCATATGCA
AAATCTCTTGTGCCTCCTACAAAAACTGCCTCTCTTCAAAGATAAAGCATGAAATGAAGATATATATATATATATATATAGCAATATACA
TTAGAAGAAAAAAAGGAAGAAGAAATGTTGTTGTATTGATATAAATGTATATCATAAATATTAGGTTGTAGTAACATTCAATATAATTAT
CTCTTGTAGTTGTTGTATCTTCACTTTATCTCAACTCCTTTGAGAGAACTTTCCGTAGTTATCTGCTTTGCACTTGGTTACTCAGAATTT
TACTGTGGGCATGATAATTGATATACCAAATTCAGTTTTGATTCTATCG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
psy1 Phytoene synthase 1phytoene synthase
Genomic locations (0)None
Library representation (17)  
mRNA member sequences (240)  
Alignment image suppressed for unigene with 240 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (22)  
Annotations (manual: 11 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (2)