Unigene SGN-U581507

Unigene Basic Information 
Unigene ID: SGN-U581507
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 972 bp

>SGN-U581507 Tomato 200607 #2 (59 members)
AAGCCAGAGGAAAAATGAAGTTCAATATTGTATCACCCGTTGCACTGTCTTGTCTCTTTTTCTTGTTCCTAACAGGTACTTTAGCACAAA
ATGCCGGTTCCATTGTAACGCGGGAATTGTTCGAACAAATGCTGAGTTTTAGGAACAATGACGCATGTCCTGCCAAAGGATTCTACACTT
ATGATGCATTCATAGCTGCAGCCAATTCGTTTCCAGGTTTTGGTACTGCTGGTGATGATACTGCACGTAAGAAGGAAATTGCTGCCTTTT
TCGGTCAAACATCTCACGAAACTAATGGTGGTAGTGCAGGAACATTCACTGGAGGATATTGCTTTGTTAAGCAAATAGAGCAGTCAGACA
GATACTATGGCAGAGGACCTATCCAATTGACACACCAATCTAACTACGAACGAGCTGGACAAGGTATTGGTGTTGGACAAGAGTTAGTGA
ACAACCCTGATTTAGTTGCGACAGATCCTATAATATCATTCAAAACAGCAATATGGTTCTGGATGACAGAACAGGATAATAAACCATCAT
GCCACAACGTTATCATTGGACAATGGACGCCATCCCCTAAAGATACAGCAGCTAATAGAGTTCCAGGGTACGGTGTCATTACCAACATCA
TTAACGGTCAATTTGAATGTGGGATGGGTCCGAATACTGCAGCGGAAAGTCGAATTGGATTTTACAGGAGGTATTGTGGTATGTTGAATG
TTCCTACTGGTGAAAATTTGGACTGTAACAATCAAAAGAACTTCGCCCAGGGCTAAGCGTCTTTATTTATATATAGAGAGAGAATGCAAA
TTATGTTTATGTATTACGTTGTGAAGTCTATAAGTTATATTTGGATGTAATCAATAAGGGGATTCTGTATGCCCATTTAGAAAAATGGAA
GTTTATTTTCAGAAATACTAAAGTTATATGATTTTGATCTTTTGTTATAAAAAAAACTCGAGACTAGTTCTC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
Z15141 acidic extracellular 26 kD chitinase
Genomic locations (0)None
Library representation (16)  
mRNA member sequences (59)  
Alignment image suppressed for unigene with 59 aligned sequences.
[Show Image]
Markers Information (2)  
Expression Data (12)  
Annotations (manual: 5 | blast: 3 | go: 4 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)