Unigene SGN-U581608

Unigene Basic Information 
Unigene ID: SGN-U581608
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1720 bp

>SGN-U581608 Tomato 200607 #2 (70 members)
GGCGATTGGCGGCCAATCGGCCGAATTCTTCAAGAACGTTAAGGCTTCGCTAGTGGAATTGGTACACACGGTGAAATGAAATAAACAATA
ATCCACTGTGGCAATCGAGGCGACCTCGACAAATTATCCACATCACAAGTCACACAGCACCGTTTAATTTCCAATTGCATGAAGAGTATA
ACCTGTCTCCACAGCCTCAAATTCGTCAGGTAGTAGGGCCGCTCCAATATTTGTACAAATCTTCTTCATCTACCTCGCACTCACACCTAG
CAGGACTACTGTGAAGCCGGCGGCAAAGGAAACTGAGAAAATGCCTGGGATTAAAGGGCCTTCCGATTATTCGCGAGAACCCCCTCGCCA
TCCTTCTCTTAAAATTAATGCCAAGGAACCCTTTAATGCTGAGCCAACTCGTTCAGCTCTGATTTCATCTTATGTCACTCCTGTTGATTT
CTTTTACAAGAGAAACCACGGACCCATACCAGTAGTGGATGACATAGAGAGGTATTCCGTTTCTCTGAGTGGTCTTATAAAAAATTCCAA
AGACTTGTTTATGAAGGATATTTGTAAGCTTCCAAAACATACGGTTACTGCCACTTTACAGTGTGCTGGTAACAGAAGAACTGCTATGAG
TAAGAGTCGAACAGTGAAAGGAGTTGGTTGGGATATTGCTGCTTTAGGAAATGCTGTTTGGGGTGGAGCCAAATTGGCAGATGTTCTAGA
ATTAGTTGGAATACCTTATTTGGCAAGTATCACACAATCTGGAGGAAAACATGTGGAATTTGTGAGCATTGACAAGTGTAAGGAGGAAAA
TGGAGGTCCTTATAAGGCATCAATTCCATTGAGTCAGGCTACAAACCCTGAAGCTGATGTTCTGCTCGCTTATGAGATGAATGGAGAGCC
ACTTAATAGGGATCATGGCTATCCACTGCGTGTGGTTGTCCCTGGTGTGATAGGTGCCCGTTCAGTTAAGTGGCTTGATTCCATCAATAT
CATTGCCGAAGAATGCAAGGGATTCTTTATGCAAAAAGACTACAAGATGTTTCCACCAACAGTGAATTGGGATAACATCAACTGGTCTAC
TAGGAGACCGCAGATGGACTTTCCTGTTCAGAGCGCAATATGTTCCCTGGAGGATGTGAGTGTTGTAAAGCATGGAAAGATAAACATCAA
GGGGTACGCATTATCAGGAGGTGGGCGTGGCATAGAAAGGGTAGACGTGTCTATAGATGGTGGTAAAACTTGGGAGGAAGCCACCAGATA
CCAGAGAACTGGTGTTCCATATATTGCTGATGATTCAAGCAGTGACAGATGGGCATGGGTCTTTTTTGAAGCTGAGGCAAATATTCCCCA
GAGTGCGGAAATAGTTGCTAAAGCGGTGGATATATCTGCAAATGTCCAACCTGAAAGTATAGATTCTGTCTGGAATCTGAGAGGAATCCT
GAACACCTCATGGCATCGGGTTCATGTCCGAGTTGGTCAAGCAAATCTTTAGGCTGTGTTTGGTGTGTTGAAGCGGATGACAGTAATCAG
CATATCAGGCCATGGTTGTTTGTATCCTTCTTAGCTTAAAATGAAAATAGCATGGTGGTTTGCGTCTTCCTAGCTTAAAATGAAAATAAA
ATGTTCTCTTGATGTTGTCTCGAAATACTTACGGAAATAATAATAATTTGGAAGTGATTGCATCTTGACAATTAATTGTGTTAGTTTCTT
CTCCAGTTTC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
sulox sulfite oxidase
Genomic locations (0)None
Library representation (25)  
mRNA member sequences (70)  
Alignment image suppressed for unigene with 70 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (2)  
Annotations (manual: 1 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)