Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

Unigene SGN-U581695

Unigene Basic Information 
Unigene ID: SGN-U581695
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 3234 bp

>SGN-U581695 Tomato 200607 #2 (44 members)
GGCACGAGAAACCTCTTCTTTCTCTCTCTATATCTCTATATATAAATATATGGGTTGTAATGGCAGTCTCTTTTTCTCTACTAATACTAG
TACAAGACACTTGCGTATTTTAATTTTTTCAGAATATTAGAAGTTTCATTAGTAAGAATACTGAGAGTTTTTTTTTTGTTGTTGAAAAAA
GGGAAGTGATGAAGTGAAAACCCGGATTTGCCCCTTAATCACCTCTAGTTTTGTGGTGGTCGGGGTGGGGGTTGGTGCCGGAAATCGGAA
AAAACTGAAAACAGGTTGCAATGTGGTGGCGGTTTATTTAATCAGGTTGTGGGTGCATTGGGTTTTTGGTTAATTTGGGTTTGTTGATGA
TACCAATGCATGTGAGGGGAAATGGAGTTTCGGATAAGAAGAAGATGATGCCTATTCTTGGGATCTGCATGTGGGGGAACCATAAGATCT
CAGTATTGGATTGGTTTTGCTCTCCAAGAGAGGATGTCTATATTTATTCTTTCTTCTGGTTTATGATTAGCGTTGGTGCTGAAATAATGA
TTTAATATAGTAAATGGGCTGAAGACGACTTGCTCAATGTTGAGGACGTTAGCATCAACTTTGTTGGTTTTGTCCTTCTTTGTTTCCTTA
TCGGCTGCTGATAATGGTTTCCCGCGATGTAACTGTGATGATGAGGGATTTTGGAGCATTGAGAGTATCTTACAGTGCCAAAAGATTAGT
GATCTCTTTATTGCGATTGCGTATTTTTCCATCCCAATTGAGCTCCTTTACTTTGTCAGTTGTTCTAACTTTCCATTCAAATGGGTGCTC
TTCCAATTTATTGCATTCATTGTTCTGTGTGGGATGACTCATTTGCTCAATTTCTGGACTTACTATGGCCAACACCCGTTTCAGCTTATG
CTTGCTTTAACCATTTTTAAAGTCCTCACTGCACTGGTATCCTTCGCCACGGCTATAACCCTTATTACCCTCTTTCCTATGCTGCTTAAA
GTCAAGGTGAGGGAATTTATGCTGAAAAAGAAGACTTGGGATCTTGGTAGAGAAGTTGGATTAATAAAGATGCAAAAAGAAGCTGGATGG
CATGTTCGGATGCTTACACAGGAGATTCGAAAGTCACTTGACCGTCATACAATACTCTACACAACTCTGGTGGAGCTATCAAAGACGCTG
GATTTGCATAACTGTGCTGTTTGGAAGCCCAATGAGAATAAAACTGAGATGAACCTAATTCATGAGCTGAGAGACAGTAGCTTTAATAGC
GCGTATAATTTACCTATCCCGAGAAGTGATCCAGATGTTATACAGGTTAAGGAGAGTGACGGAGTAAAGATACTTGATGCCGACTCCCCA
CTTGCTGTTGCGAGTAGTGGAGGGAGTAGGGAACCAGGAGCTGTGGCTGCAATTAGGATGCCGATGCTTAAAGTGTCGAACTTCAAAGGT
GGAACTCCTGAACTTGTCCCAGAATGTTATGCCATACTGGTTTTGGTTCTACCTAGTGAACAAGGTAGATCATGGTGCAGCCAGGAAATT
GAGATAGTCAGGGTTGTGGCTGATCAGGTTGCTGTGGCTCTGTCCCATGCTGCAATTCTTGAAGAGTCTCAGCATATGAGAGAAACATTG
GAAGAGCAAAACCGAGCTCTGGAACAAGCAAAGCAGGATGCACTTAGGGCGAGTCAAGCAAGGAATGCATTTCAGATGGTTATGAGCCAT
GGTCTGAGAAGACCCATGCACTCAATATTGGGTCTGCTCTCCTTGTTGCAAGATGAGAAATTGGGTAATGAGCAGCGGCTTCTTGTGGAT
TCAATGGTTAAAACCAGTAATGTCGTGTCAACCCTAATAGATGATGTGATGGATACTTCAACAAAGGACAACGGTAGATTCCCTTTGGAG
ATGAGATATTTTCAGCTACATTCCATGATAAAAGAAGCTGCTTGTCTTGCCAAGTGTTTGTGTGCTTATAGGGGTTATAATATTTCCATT
GAGGTTGACAAATCTTTGCCAAATCATGTTCTCGGTGATGAAAGAAGAGTTTTTCAAGTTATTCTTCATATGGTTGGAAATCTTTTGAAG
GACCCCAATGGAGGTCTTCTCACATTTAGGGTTCTCCCAGAAAGTGTAAGTAGGGAAGGCATTGGTGGAGCATGGAGAACAAGGAGGTCA
AACTCATCTCGTGATAACGCCTATATCAGGTTTGAAGTTGGAACAAGCAATAATCATTCTCAGCCAGAGGGGACCATGTTGCCACATTAC
AGGCCAAAACGCTGCAGTAAGGAGATGGATGAAGGCTTGAGTTTCACTGTGTGCAGAAAGCTGGTTCAGTTGATGCAAGGAGACATCTGG
GTAATCCCAAATCCAGAAGGTTTTGATCAAAGCATGGCTGTCGTTCTTGGGCTTCAACTGCGGCCATCAATTGCCATAGGCATTCCTGAA
TATGGGGAATCTTCTGATCATTCGCATCCACACTCACTCCTCCAAGGTGTTAAAGTTCTGTTAGCAGATTATGATGACGTGAATAGAGCG
GTAACAAGTAAGCTACTTGAAAAATTGGGATGCAGTGTTTCTGCAGTTTCATCTGGACGTGACTGTATTGGTGTTCTTAGCCCTGCTGTA
TCCTCATTCCAAATCGTCCTTTTGGATCTTCACCTGCCTGATTTGGATGGCTTCGAAGTAACCATGAGAATTCGGAAGTTTGGTAGCCAC
AACTGGCCATTGATAGTTGGTTTAACTGCGACTGCTGATGAAAATGTTACTGGAAGATGCCTGCAGATTGGAATGAATGGACTTATTCGT
AAACCAGTGCTATTGCCAGGTATCGCTGATGAGCTTCAAAGGGTTCTGCTACGGGGAAGTAGAATGATGTAATTGATGTTGACGGTGCCT
TATAGGAGTGGAGTTTATAAGGCAGGGCTTCATCAACCACGTAATGCTAGATGTTCAAACGAAATTGCTTGGACCACTTCCCACCCCTGA
AGATTCCAGCATACAGATGTAACGTACATACAATCTTTGAAATCAAAATGGTACAGAAAATATATCGTCTTTTCTACTCTCATAAAAGCC
CTCAGCTCTAAAGGATTTGAGCCAGGTTTGCCGATTCTACATGTTATTGAGCTTAGCAACTCAGAATATTTAACTAATCTGTTGTTAGAA
CTGAAAAGTATATACTGTTGAGAAATGACTCCAGAATAGCTCCATTTCTAAGTGTTCTGGAGCACTATTAGATTTGCATTTGCA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
etr4 ethylene receptor homolog (ETR4)ethylene receptor
Genomic locations (0)None
Library representation (17)  
mRNA member sequences (44)  
Alignment image suppressed for unigene with 44 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (4)  
Annotations (manual: 5 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)