Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U583132

Unigene Basic Information 
Unigene ID: SGN-U583132
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 1278 bp

>SGN-U583132 Tomato 200607 #2 (9 members)
TAGGCAATCATTCATCTTTTTGCTGAGTCAATTGCTGGAGCTGGAACAATCAGAGGTTTTGGACAAGAAAAGAGATTTATGAAGAGGAAC
CTTTATCTCTTGGATTGCTTTGCTCGACCATTCTTCTGCAGTCTTGCAGCAATCGAATGGCTTTGCCTACGCATGGAGTTGCTCTCTACA
TTTGTCTTTGCTTTCTGCATGGTTTTACTTGTGAGCTTTCCTCATGGGAGCATAGATCCTAGTATGGCAGGTCTTGCTGTGACATATGGC
CTAAACTTGAATGCACGCCTGTCACGATGGATACTTAGTTTCTGCAAGCTTGAAAACAAGATTATTTCAATAGAAAGGATTCATCAATAT
TGTCATATTCCTAGTGAGGCCCCACAAATTATTGAACCTCGTCCCCCATCGTCATGNGCCAGAAGAAGGAACCATTGAACTGATTGATTT
AAAGGTTCGTTATAAGGAGAGTCTTCCAGTTGTGCTTCATGGTGTATCCTGCAAATTTCCTGGAGGAAAGAAAATTGGAATTGTGGGGCG
CACAGGTAGTGGCAAATCTACTCTGATTCAGGCTTTATTCAGATTGCTGGAACCAGAAGGTGGAAAAATAATTATAGACAACATTGATAT
TTCAACCGTTGGCCTTCATGACCTTCGTAGTCGTCTGAGTATAATTCCCCAAGATCCAACATTATTTGAAGGGACAATTCGTGACAACCT
TGACCCACTTGACGAACATTCAGATCTAGACGTATGGCAGGCACTTGAAAAGTCCCAGCTTGGAGAGGTTGTCAGGAATAAAGATCAAAA
GCTTGATACACCAGTCCTGGAGAATGGAGAGAATTGGAGTGTGGGCCAGCGACAGCTTGTATCTCTTGGGCGGGCTTTACTTAAACAAGC
CAAAATTTTGGTGCTTGATGAAGCGACGGCCTCGGTTGACTCAGCAACAGATAACCTCATCCAGAAGATTATTAGGACAGAGTTTAAGGA
CTGCACTGTTTGCACCATTGCACATCGTATCCCTACAGTTATTGACAGTGATCTTGTCCTGGTCCTCAGTGATGGTCGGGTGGCTGAGTT
TGATACTCCAGCACGACTCTTAGAGGACAAATCTTCTATGTTTCTCAAGTTGGTATCAGAGTACTCAACAAGATCCAGTGGCATGCCTGA
TTTTTAATTCGGGTAGCAAGCCTGAGGATTTTGATGGGAAAACAAAGAAGAGCAGAATGCCAGAGGAAAAATGAACTGGCTAGCACTCCT
GCTGCTGCTTCATTGGGC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
Solyc09g064440 Solyc09g064440
Genomic locations (0)None
Library representation (4)  
mRNA member sequences (9)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 1 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (2)