Unigene SGN-U583803

Unigene Basic Information 
Unigene ID: SGN-U583803
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 887 bp

>SGN-U583803 Tomato 200607 #2 (12 members)
GCCAAAAATTATTTCACAAGTACACTATCCTTTACTTGTGCTCCAAAACCCTAGCCCTAAAACCCTCTGCCAAAGTGAGACACTTTGCTC
GAGCGATATGTCGGGAAGAGGAGAAGATAGTGATTCCGATGCGCCGGAAGAACTAACTTCCGTACAGGGAATTCAAAACAATGAGGAGAT
TAGAAAAGTTGAAAAAGAACACAAGGCTAGAGTTGTTCGGGAAAGGAAGGAACGTCGTAGACAATGGGCTCAAAAGTTAACTCCACGACC
TAAACAAAATGATGAAAGCATTGAAGACACAAAAGAACCTGAAGATGCCCAAGAGTCAAAGGACAATAGAGGGATGCTGCCTGATGAGAT
TGTAAAAATTCTTGCAGCTCGTGAAAAGAAAGTTTTCTCGTCAGACTCGGAAGAAGAACATGAGAAGCAGCCTACATCTAAAAACAAAAG
ATCCAAGAGCTCTGGGTCTGGACCAGTTATTTTGAAGGATCTACCACCTCCTCCGTGCTTAGAGAGCTCACTGGCATTCTTGAAGAAACG
TAAGATGCAGGTGTCAAGATCATCAGCTGTTCTGAACAATTCCAGTCAAGCATTACGCCTTCTATCTACATCTGGCTTGCTACGTACGAA
ATGATAGGTGATGATTTTGAAGATTTTAGCCCGAGTGATGTCAATGCTGTATTGCTTGCTGTAATGAGAATATGCTGGTAGAGGTGTTAA
ATGGCGAGCTGGTTTTGGACACTGATGGGTAAACCAAAAAAACAAAACAAAACATTGTAACAACTTTTTGATGGTATATTGCAATTTTAT
TGATACTTGTGGGTAGGAACTGCTGAACTGTTTACACTGCAACAGTCTCATCTCAGTCAGAGTGTTGAATCATTAAG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
Solyc02g065370 Solyc02g065370
Genomic locations (0)None
Library representation (8)  
mRNA member sequences (12)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (2)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)