Unigene SGN-U586875

Unigene Basic Information 
Unigene ID: SGN-U586875
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 561 bp

>SGN-U586875 Tomato 200607 #2 (1 members)
GCTCTGATCATGACAATGAAGGAAAAGAGCATAATGTGGTGGTTGAGCAGCGGCATGTGGAGAACTTCGAGATGCAAGCGAATGAACCAG
TAACTGCCTATTGAAGTCCCAGGTAAGAATGCAAACGAGCTTAAGGAATGGAAGAAAATGGACATGTTACCGGCATCTCCTACTGCCAGC
CAAGTATCCTGTGATAGTGATGCCCTGTCTGAAAGCGACAGAAAAATTATAGAGGAGAATGAAAAATTAAGGGAGATGATGGAGAAGTTA
ATCAAATCAGGGAACGAACAGCTGAGTGCCATATCGAGTCTTTCTGGAAGAGTTAAAGAGCTGGAGAAGAGATTGTCCAAGAAGAAGAAG
CTAAAATTGAAACGAAATAGGGTACCAGCAGCTGGATCAGCCTGTGTAAAGCCATTGAATGACTCACTTAGAAATAGGAATGTGGGGTTG
GCAATGTAAAAACAAAAAGCTTGGTCATTCCTTTTCATAGAATAGTAATTTGGTTCATGTGGTCTGTTTGCGTTCCATTGTATGCTATGT
ATAAATAAGGCTTCTTCTGCT


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
Solyc01g095330 Solyc01g095330
Solyc01g095340 Solyc01g095340
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E712330
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)