Unigene SGN-U588691

Unigene Basic Information 
Unigene ID: SGN-U588691
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 436 bp

>SGN-U588691 Tomato 200607 #2 (1 members)
CCTGGTCCTTTCAATGCTCGTAAGTGCTAAATTTGTTGTCCTTGTATACGCGGATAGTTATCCCATCCTTTTCGATAACTCCCAAGTCGA
CAAGGAAAACTACTTTGAAGGTACTTTTATGTCCTCTCCATCTTTCAATGGTGGTTATAAGGTTTGTGGTTTTCTTGGTACTAGTGACCC
TAAACACACCACTCTAAAAGGTCTTTTCTTGTCCACACTAACTAGATTGCATGACAAGTTGATCCCTATCTTTACTACATCAATCACTTC
AATGTGTACCAGTCTTGAAAAAGAACTGTCTGAGAAAGGAACGTCTTACTTCAATGCCATCGGTGACAACTTGTCATATCAATTCCTCTT
TCGATAGGTGTGGGAAGGGAGAAATACAATTGATACAAGTGTTGGCCCTAATGGACCAAAAATTGTTGACAAATGG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
CYP74C3 cytochrome P450 CYP74C3cytochrome p450
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E267760
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)