Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

Unigene SGN-U589505

Unigene Basic Information 
Unigene ID: SGN-U589505
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 699 bp

>SGN-U589505 Tomato 200607 #2 (1 members)
GGTTCAGTAGAAGAGAAACCCTAAGTGCTTGCGGTTTGGGTTTTTCGGCGGTTTTGTTCGAGGCTCTTTTGCAGCCACAGTCGAATATTG
AAGCAATTGCTGAAGAAGCTGCAGCTACGGAATGTGAGTTCACAGTTACACCTTCAGGTCTTGCTTATTGTGATAAAGCTGTAGGTTATG
GACCTGAAGCTGTTAAAGGACAATTGATCAAGGCACATTATGTAGGTAAACTGGAAAATGGGAAGGTCTTTGATAGCAGCTATAATCGTG
GAAAGCCTCTTACATTTCGCGTTGGTGTTGGCGAGGTTATTAAAGGTTGGGATCAGGGAATTCTAGGAGGTGATGGTTTTCCTCCAATGC
TAACTGGAGGAAAGCGTAAACTGAAGATTCCTCCAGAACTTGGATATGGGATAAGAGGAGCTGGCTGCAGAGGAGGTACGTGCATTATTC
CTCCAGACTCAGTTCTACTGTTCGATGTGGAGTTCGTTGGCAAGGCGTAGGTCTCAGCTATAGAGGTATAGTTTCTAGCTACTCATAAAA
TGATCGATCAAAGGGCAAAGTTTTTGTAAGCTTAATACTTTTAGAGACTTTTGCAGTACATACCGTGACCTGCTTGTATATTTTTGGTTA
TCTTTACAAAAATTACAATTATTTCGTACAGAATGTTACAAACTATATAAAGTAATTTTGCGAGGAACC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
SlFKBP13 FK506 binding protein 13
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E734939
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 1 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)