Unigene SGN-U589888

Unigene Basic Information 
Unigene ID: SGN-U589888
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 712 bp

>SGN-U589888 Tomato 200607 #2 (1 members)
CGAGTCTGGAAGTATATTTGAGGGACTTCTTCCTAATGGTCTAAATATTTATGCCACAACAGCTTCAAATGCTGAAGAAAGCAGCTGGGG
AACCTATTGTCCTGGAGAATATCCTAGTCCTCCTCCTGAATATGAGACTTGCTTGGGTGATTTGTATGCTGTTTCCTGGATGGAGGACAG
TGAAATGCACAACTTGCGGACTGAAAATTTGAGGCAGCAGTATCACTTGGTCAAAAAGAGAACTGCAAATGGAAATACTGCCTATGGTTC
CCATGTCATGCAATTTGGTGATCTACAACTGAGTATGGAGTCTCTATTCAGGTTTATGGGTACAAATCCTGCAAATGATAACTACACTTA
TGTAGATGACAATTCCTTGTTGGCATCATCAAAGGCTGTCAACCAGCGTGATGCAGATCTTTTACATTTCTGTTTGGAATTCAAAAAGGT
CCTGAGGTGCTGAAGCATGTTCGATCTGCGGGTCAGCCTCTTGTTGATGATTGGGCCTGCCTTAAATCTTTTGTAAGAACATTTGAGTCG
CACTGCGGATCGTTATCCCAATATGGAATGAAACACATGCGTTCCATTGCCAATATCTGCAATGCTGGAATTCAGATGGAGCAGATGGTG
GAGGCATCAGCACAAGCTTGTCCTAGCATCCCTTCCAATATTTGGAGTTCCCTCCCAGGGGCCTTAGTGCGTAAAAGCCATG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
cysp cysteine proteasecysteine protease
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E347019
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)