Unigene SGN-U590004

Unigene Basic Information 
Unigene ID: SGN-U590004
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 632 bp

>SGN-U590004 Tomato 200607 #2 (1 members)
ACGAGGTGATCTTTAAAATGGCACCAAACTCAAAAACAAAAAACCAATCTTTATCTAAACAAAAAACCATTTCAGTAATGCCCACTGTGT
TGATTTTCACAAAATTTTATTATTTTCTTCTTATCCACATTCAATAATATTCACAAAAAATGAAACTACACAAATTCACCTAAAAATTGA
AATCAACAACAAAAAAAAATCAAATCTTGAAAACCCCCTTTTAAATAGAAGAGCAAAAAAATCAAATCTTGATTTGCCCCTTTTTGTGTT
ATTGTTGTTTTTAAATAAAAGAGCAAAAAAAATCAAATCTTGAAAACCCCTTTTCTGTTCTAATGGGTAAAGGAGGCAGTGATGAAAATA
TGGCTGCTTGGCTTCTTGGGGTTAACACCCTCAAGATTCAGCCTTTCAATCTCCCTGCTTTGGGACCCCATGATGTTAAATTTAGGATGA
AGGCTGTCGGCATTTGTGGAAGTGATGTTCATTACCTCAAGACCATGAGGTGTGCGGATTTTGTGGTTAAAAAACCAATGGTGATTGGGC
ATGAATGTGCCGGGATCATAAAGGAATTTGGCGGTGAATTAAAAACATTGGTTCCTGGAGATCGTGAAGCACTAAACCCCGAAATTACTT
GT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
sdh sorbitol related enzymesorbitol related enzyme
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E730180
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)