Unigene SGN-U590050

Unigene Basic Information 
Unigene ID: SGN-U590050
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 213 bp

>SGN-U590050 Tomato 200607 #2 (1 members)
GTAATTTTGTTTGAGAGTGGAAATATTCTCTAGTGGGAATCTACTAGGAGTAATTTATTTTCTATAAACTAAGTAAAGTTTGGAAGGTGA
CAAAAAGAAAGACAAAAATCTTGGAATTGTTTTAGACAACCAAGGTTTTATTGTTCAGAATGTCTGTTGCCTTGTTATGGGTTGTTTATA
CTTGTGACGTGTAAAATGGGACAAGTTTTATGG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
psy1 Phytoene synthase 1phytoene synthase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E274989
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (1)  
Gene Family (0)None
Preceding Unigenes (1)