Unigene SGN-U590177

Unigene Basic Information 
Unigene ID: SGN-U590177
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 662 bp

>SGN-U590177 Tomato 200607 #2 (1 members)
TTATTAAAATTAAACCATGGCTGCTTCTACAATGGCTCTTTCCTCCTCTACCTTCGCCGGATAGAAGGTGAAACTCGCACCATCTTCTTC
TGAAATCAGTGGAAATGGGAGAATTACAATGAGGAAGACTGCTGCCAAGCCCCAAGCTATTTGACTGGTGAGTTCCCTGGTGATTACGGA
TGGGACACTGCTGGGCTTTCAGCTGACCCTGAAACATTCGCTAAGAAATCGTGAGTTGGAGGTTATTCATTGCAGATGGGCCATGCTTGG
TGCTCTTGGATGTGTTTTCCCCGAGCTTTTGGCACGTAACGGTGTTAAGTTTGGTGAAGCTGTATGGTTCAAAGCTGGATCTCAAATTTT
CAGCGAGGGCGGACTTGACTACTTGGGAAACCCTAGTTTGGTTCATGCACAAAGCATTTTGGCTATTTGGGCTTGCCAAGTTGTGTTGAT
GGGAGCCGTTGAGGGTTACCGTATTGCTGGTGGGCCTCTTGGTGAGGTTGTTGATCCACTTTACCCTGGTGGTAGCTTTGACCCATTGGG
CCTTGCTGAAGACCCAGAGGCTTTTGCTGAGCTCAAGGTGAAGGAGATCAAGAATGGTAGACTTGCTATGTTCTCCATGTTTGGATTCTT
TGTTCAAGCTATTGTCACCGGAAAGGGTCCGT


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
Solyc03g005760 Solyc03g005760
Solyc03g005770 Solyc03g005770
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E347883
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)