Unigene SGN-U590388

Unigene Basic Information 
Unigene ID: SGN-U590388
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 782 bp

>SGN-U590388 Tomato 200607 #2 (1 members)
CCCTTATAACATAGAAGTCCACCACCACCTACTCACAAAATTTCTTCTGTAACTCATCATTCACCTCCTCCACCCTCACCTGTATATTAC
CACCCATCTCCATCGTCCCCACCACCACCACCAGTTTATTATTCTCCACCACCCCCCGTGTATCATGAGCCACCACCTACTTACAAGCCT
AAATCACCACCACCACCACCAACACCGTCGTATGAACATCCAAAAACTCCATCATCACCACTACCACCAACACCGTCGTACGAGCATCCA
AAAACTCCACCATCACACGAACACCCAAAAACCCCATCACCACCAACACCATCATACGAGCATCCAAAAACACCATCACCACCAACACCA
TCATACGAGCATCCACAACCCCAATCACCACCACCACCACCACCAACACCATCATACGAACACCCAAAAACTCCATCACACCCAACCCCA
CCTACCCCACCTTGTAACGAACCACCACCTCCACCTCCTAATTCACATTGGGAACCAAAACCATCACCACCATACACCTACTCATCACCA
CCACCTCCATCACCATCTCCTCCTCCCCCCACTTACTACTACTCATCACCACCGCCACCATCACCATCACCTCCCCCGCCCACTTACTCT
TCTCCGCCACCACCACCAACCATTCTACAAACATATTCCCTCTCCCACCGGTAATCGGAGTCTCCTACGCATTCTCCACCACCCCCAGTC
ATTCCATTATTAATGGAACAAGGGTTATTCAATTAACCCTTTTGATTTTCCATTATCAAAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
X55687 entensin X55687extensin
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E707354
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)