Unigene SGN-U590510

Unigene Basic Information 
Unigene ID: SGN-U590510
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 362 bp

>SGN-U590510 Tomato 200607 #2 (1 members)
TTTGTACAAATCTTCTTCATCTACCTCGCACTCACACCTAGCAGGACTACTGTGAAGCCGGCGGCAAAGGAAACTGAGAAAATGCCTGGG
ATTAAAGGGCCTTCCGATTATTCGCGAGAACCCCCTCGCCATCCTTCTCTTAAAATTAATGCCATGGAAAGATAAACATCAAGGGGTACG
CATTATCAGGAGGTGGGCGTGGCATATAAAGGGTAGACGTGTCTATAGATGGTGGTAAAACTTGGGAGGAAGCCACCAGATACCAGAGAA
CTGGTGTTCCATATATTGCTGATGATTCAAGCAGTGACAGATGGGCATGGGTCTTTTTTGAAGCTGAGGCAGATATTCCCCACAGTGCGG
AA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
sulox sulfite oxidase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E284951
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)