Unigene SGN-U590566

Unigene Basic Information 
Unigene ID: SGN-U590566
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 301 bp

>SGN-U590566 Tomato 200607 #2 (1 members)
TTTTTTTTGGGTTTTGGACAGCCGTGGGAGTAAGGGCATTTTTGACCTTCCAAACTCCAAAATCATCAACAATTCAATGGCCGTCTCTAG
TTACGCTAGGGCATTTCCGTCATTCGAATGTCGTTCGGAGCCTGATTTCTCCGGCAGCCTTCCACATCCTAAAGCCGGCGTTCGGTTCTC
CGGCAAGTATAACTCCGGGAGTAACCGATCTCAGGTTTATGGACTGTCTTCTTTGATCTATAGGTTTCCGCCTAATTTCGTGATGCAGCT
TAGCATTAAGGCTATGAAGAATTGCAACAAC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
AY508112 cystathionine gamma synthase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E267475
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)