Unigene SGN-U591949

Unigene Basic Information 
Unigene ID: SGN-U591949
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 422 bp

>SGN-U591949 Tomato 200607 #2 (1 members)
TGGCTTCCTCAATTGTCTCATCGGCAGCCGCTGCTACCCGTAGCAATGTTGCTCAAGCTAGCATGGTCGCACCCTTCACCGGACGCGTTA
GATGCATGCAGGTGTGGCCACCAATCAACATGAAGAAATACGAGACATTGTCATACCTTCCTGACTTGTCCGATGAGCAATTGCTTAGCG
AAATTGAGTATCTTTTGAAAAATGGATGGGTTCCTTGCTTGGAATTCGAGACTGAGCGCGGATTTGTGTACCGAGAGAACAACAGTTCCC
CTGGATACTACGATGGTAGATACTGGACCATGTGGAAGTTACCTATGTTTGGGTGCACTGATGCAACACAGGTGTTGGCTGAGGTTCAAG
AGGCGAAGAAGGCGTACCCACAAGCCTGGGTTCGTATTATCGGATTCGACAACGTTCGTCAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
TOMRBCSD RuBP carboxylase small subunit
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E278619
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)