Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U593067

Unigene Basic Information 
Unigene ID: SGN-U593067
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 666 bp

>SGN-U593067 Tomato 200607 #2 (1 members)
AACACTTTATTTGTTCAAAAGTCATTCCTATTAGACACAAAATGCTGACATAGCAAAAAACATGTAATTCACTTTCCTTGAGCGCGTTAA
TTTATTAAAAATAATATTTTTCTTTTTTTTTTTCTTAATTTATACCCCTAAGTTAATTTTTTAAAAAATAATTAACAAAAAAGAAGAAGA
ACAATTGTATTCTTCTTCCCTATTTCTATCAACCCCACCCCACCCCACCCCAACCCCCATACCCATGCACCAGTGGTTATCTTCTTCCCC
CACCATTCTAATGATTTCAAAATTCTTAGCATCAGTGGTTATCTTCTTCCCCCTCCAACATCACCATTGTAACAAAGAATTGGAATCGAA
TTCCAAAACCAAGCAAAGAGAGCAATGGCTGCTTCCACACAATGTTTCTTGCACCAATATCATGCACTAAGATCTAGCCCTGCTAGAACC
TCCTCTGTTTCATCTCCTAAGCCTAACCAATTGATTTGCCGTGCACAAAAGCAAGATGATGCCAGCAACGCCGTGTCGAGACGATTGGCT
CTTACTCTCCTCATTGGTACTGCTGCCATTGGTTCCAAGGTTTCCCCTGCAGATGCTGCCTATGGAGAAGCTGCAAATGTTTTTGGGAAG
CCAAAGGAAAACACTGATTTCTTGCCATACAATGGA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
psbx psbXphotosystem II 23 kDa protein
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E359423
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)