Unigene SGN-U596740

Unigene Basic Information 
Unigene ID: SGN-U596740
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 622 bp

>SGN-U596740 Tomato 200607 #2 (1 members)
CCCTCTTATGGTACTCCAGAATTCATGGCACCAGAGCTTTATGACGAGGAATATAATGAGCTAGTAGATATCTATGCTTTTGGCATGTGC
TTGCTGGAGCTGGTGACTTTTGAGTATCCATATGTTGAGTGTACGAATGCTGCCCAGATATATAAGAAAGTAACATCAGGAATTAGGCCT
GCATCACTGGCAAAAGTAAAGGATCCAGGAGTTAAAGCATTTATAGAAAAATGTATAGCAAAAGTTTCTGAGCGTCTGTCTGCTAAGGAA
CTATTGATGGACCCCTTTCTCCGGTCAGATGATGATTCTGCAAGCATATCTAGATCCTTGAGTTCCCACCCCATACATGCTGATAACAGT
GATGATGATAGTGGAAGAAGTCCTCAGGACCATGTGCCTGAAGGAAGCAGAGATTTCACAGTACAGGGCCAACGGAAGGACCTAAACACA
ATTTTTCTCAAACTGCGAATAACTGACTCTACAGGTCATATTAGGAATATTCATTTCCCCTTTGATATTGAAGCTGATACAGCAAATGCT
GTTGCTAGTGAAATGGTTGAAGAGTTGGACCCTGACAGATCACGACGTCTCTGCTATTGCTGATATGATTGATTCACAAATC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
SlMAPKKK27 MAP kinase kinase kinase 27MAP3k cascade
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E699239
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)