Unigene SGN-U600798

Unigene Basic Information 
Unigene ID: SGN-U600798
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 479 bp

>SGN-U600798 Tomato 200607 #2 (1 members)
GCATCCATCAAGCTGTGCAAACTGAAACTAGAGCCTTATCAAGAAATAACAACATTCATGGAATTCAAAGTCAAATGTCTTCTAGATCTA
GTACATTAACAAAGTTGAAGTTCCTCTGCAGTTTTGGTGGTAGAATTATGCCTCGTCCAAGTGATGGGAAACTTAGATATATTGGAGGTG
ATACGCACCTCGTCCGTTTAAGAAATGATGTTTCTTGGGAGGAATTCTGGCAAAAGATGTTAACTTTATTTAACAATTGTCACACAATAA
AATATCAGCTTCCTGGTGAGGATCTTGATGCATTAGTGTCAGTTTCTTGTGATGAAGACTTGCAGAATATGATAGAGGAATTTAATGTAT
TAGAAGGTGATGGATCACAAAAATTGCGTACATTTCTCTTTTCTTACAGTGACTTGGATGATTCTCTGGCTGGTTTGGAGAATATTGAAT
GAGATCCAGAAATGCAGTATGTTATTGCT


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
SlMAPKKK12 MAP kinase kinase kinase 12MAP3k cascade
Solyc02g031910 Solyc02g031910
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E309989
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)