Unigene SGN-U601309

Unigene Basic Information 
Unigene ID: SGN-U601309
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 699 bp

>SGN-U601309 Tomato 200607 #2 (1 members)
AACTGGAAGTAATTCCAAAGTTACTTGCGATTGTTATGTTGAGAATCATACAAGATGTCGAGTGGTGGAGATGGATTTCTCCAATAGACG
AATAGAAGGTTGGATCCCTAAGAACATTGGAAACCTCAAATATTTGACTACTCTTAATTTGGATGGGAACAAGTTGAGGGGACCAATTCC
TGAATCATTTGAAAATCTGACGCGACTAACGCACATTTCTCTCTGTGATAATTCATTAAACGGAACAATTCCACATTTCCTTGGTTACAT
GAGCTCCTTAAAAAAAATTTCTTTGTGCAAAAACATGTTCGACGGAATAATACCTCCAAATTTGAAGTCTCTCGAATCTTTGGAAATATT
AGAGTTGAGCTATAATTTATTATCAGGGAACATATCTGAGCTGGGAGGAATTGGGACCCTCACCGAATTGAACCTGGCGGATAATCAACT
CTCGGGTGAACTCCCGGATAGCCTCACAAGTTTCGTGAATCTTGAGGAGTTGCAGTTGCAGAACAATGAATTTGTTGGTGGCTTGCCGTC
GAGCTTCTATAGTTTGGTGAACCTGAAAACTTTCGATGTGCGANGGAACAACCTCAGTGGAAAAATCCCGGATTTTACCGAAGGGTGGAA
AAATCTGCTTATCATGAATCTGATGGGGAACAATTTTTCTGCACCATTGCCTCACAAGTTCTCAGAGCT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
lesk1 protein kinase LESK1
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E314911
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)