Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

Unigene SGN-U604696

Unigene Basic Information 
Unigene ID: SGN-U604696
Unigene Build: Tomato 200607 #2
Date: 2009-03-25
Organism: S.lycopersicum
S.habrochaites
S.pennellii
S.pimpinellifolium
S.peruvianum
S.cheesmaniae
S.lycopersicoides
Alternative ID: none
mRNA sequence: Length: 541 bp

>SGN-U604696 Tomato 200607 #2 (1 members)
GAAAGTTTTGCAATAGTCGCTGGAATTGGACCTTCAAGCATATTGTTGCCGAGTGAGATCCCCATTAATGTTTTTGACTCCCATAGTTGA
TCTGGTACCATCCCAGAGAATTGGTTTTTCGATAGCTCAAGAGTAATAAGCTGAAGCTCCCCAAGATAAGAAGGCAGTTTACCTGAGAGA
TTGTTTCCAGACAACACCAAGTCTGTGAGGCTTGAACAGTTCGCGAAAGTACTTTGGATGTCACCAGTGAAGTTGTTATCCGACAACACC
AGCACGCTCAATGATTTGGCACCACATATCTCTGAAGACAACTCACCAGATAGACTGTTAGCACTGACATCAAGAACAGATAGCAAAGGG
AGATACAGTGGTGGGAGAGGTCCACTTAGGAAGTTCTTTGACACCATTATTGACTCTACTTGCGTCCAGTTGGAAATCCACATAGGCAGG
GGGCCTGATAAGCCGTTTGAATCAAGCACAAGTGATTTAAGTGAATCCAACCCAGAAAGTTCATCAGGTAATGCCCCCTGAAAATGAGTT
G


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
Solyc09g098420 Solyc09g098420
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E214181
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)