Unigene SGN-U606475

Unigene Basic Information 
Unigene ID: SGN-U606475
Unigene Build: Coffea arabica #1
Date: 2009-11-04
Organism: C.arabica
Alternative ID: none
mRNA sequence: Length: 1233 bp

>SGN-U606475 Coffea arabica #1 (4 members)
GGCCGGGGGAGCGTCAATCGCCTTTAGCGTTTCTTGGTATCCTTAAAATAAGAAGAAAAGGCGCACATTTCCAAACCAAAAGCACGTAAT
CCCTTCTTTCCTTTTTCCTCTTGTTTTCTCTTTCGGTAAGAAATCTTTTCCTGTTTTATCTTTTACCAAAAGAACCGTTGATCCTTCGTT
GATTCAATCATGGAAAAACCAGTCAAACGCCATTTAACACCGACAAGTTGATGATAGACCAACTCAGAGTCGTGGGCACACACCGCAACA
CAGCACTATTTATCATCATTCATTGTTACCTCTCTGGTCATTGTCCCTGCCTCCACCCTGTCTCCTCAGCCACCTCTTCTCCACCATCCC
ACATCTTTCTGCTCATTTCCTCCTCCCAAAAAACCCACCACCCTCCCCTCCAGCTCACAGTTTCTTCGCATGGATTCATCAGATGAAGAG
GGATCAGAGGAGTATTTGTTCAAGATAGTGATAATAGGGGACTCAGCAGTGGGAAAATCCAACTTGTTGTCTAGATATGCAAGAAATGAG
TTCAACCCGCATTCTAAAGCCACAATTGGGGTGGAGTTTCAGACTCAGAGCATTGAGATTGATGGCAAAGAAGTTAAAGCTCAGATTTGG
GATACTGCTGGTCAAGAACGCTTCCGGGCTGTCACCTCTGCTTACTATCGTGGTGCTTTTGGCGCGCTTTTGGTTTATGATATTACTGGA
AAGGATACTTTTGAAAGCGTGAGAAAGTGGCTTGATGAGCTCAATGCGCATTCTGATTCGACTGTGGCAAAAATGCTGGTTGGAAACAAA
TGTGATTTGGAGAGTATGAGGCAGGTTTCTGTTGAAGATGGGAAGAGTCTAGCTGAGGCAGAAGGATTCTTTTTCATCGAAACATCAGCT
TTGGATTCCACTAATGTTAAACAAGCTTTTGAGATTGTAATCCGCGAGATTTACAGCAATGTGAGCCGGAAAGTCTTGAATCCAGATATG
TCCAAGACAGAATTGTCTGTCAACAGGGTAAGCCTTGTAGATGATGGTGCAAAGGGATGGGGAAATTATACATGTTGCTCAGGATAAAAA
ATCTAGAGGTGGGTGGTTGGTTTTCAGGCAATTTGCCTGAACTGGAATTGGCGCGGCGTTTTCCATGATGGATTTCACATAGTCAAGATA
AGATAGCCTTAGCAAAATCAATTTTCTGATCAGATAATTTACACACACATGATACAGAAGAGA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (3)  
mRNA member sequences (4)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 6 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (0)None