Unigene SGN-U615128

Unigene Basic Information 
Unigene ID: SGN-U615128
Unigene Build: Coffea canephora #3
Date: 2010-04-15
Organism: C.canephora
Alternative ID: none
mRNA sequence: Length: 1632 bp

>SGN-U615128 Coffea canephora #3 (6 members)
GGCCGACGAAGCTGACAAAGAAGCTGCAGGAACCTCCGAGGAAGTTGAAATCGATGCATTAGCGATCGATGAGTCCAAGAAAGTTAAAAA
CGACCTTACAGATCCGGACGACTCGTCCATCGAAGCTGTCACATCGGGGGACACTCCTTACGCATCAGCAAAGAAGTTTGAGGACTTGAA
TTTGTCTTCCGAACTGTTGAAGGGTTTATACGTAGAAATGAAATTTGAGAGACCTAGCAAGATCCAAGCAATCAGCTTGCCGATGATTCT
GACTCCACCATTCAAGAATTTGATTGCTCAAGCCCACAATGGTTCGGGAAAGACCACTTGCTTTGTTCTTGGTATGTTGAGCCGTATGGA
CCCAAAGCTCTCGGCTCCTCAGGCTCTCTGCATCTGCCCCACTCGCGAACTAGCAATTCAGAATATGGAAGTATTGTTGAAGATGGGGAA
ATTCACAGGGATAACATCAGAATTAGCTATCCCAGCAGATAGTGCCAGCTTCATACCAATCTTAAAGAGACCTCCTGTTACAGCACATGT
GGTGATTGGAACACCTGGTACAATAAGTAAGTGGATAACAGCAAGGAAACTGAGCATGAGTTTCATGAAGATTCCTTGTGTTTGATGAGG
CAGACCACATGTTAGCTGACAGCGGGTTTAAGGATGACTCTGTAAAAATTATGAGAGCAATAGTTCAGAGCAGCCCTGATTGCCAGGTTC
TCCTGTTTTCTGCCACATTTGATGATGCAGTCAGGGCTTTTGTGGATAAAATAAACAAGGACATCTTTAACAGAGATTATAATCAAATGT
TTGTGAAAAAGGAAGAACTATCGCTGGAGTCTGTGAAGCAGTACAAGGTCCAGTGTCCAGATGAGCTTGCAAAAGTCATGGTTGTTAAGG
ATAAAATCCTTGAACTAGGAGAAAAAGTGGGTCAGACAATCATATTTGTTCGAACACGCAACAGTGCTAGTGCACTGCATCAGAGTTTAG
TTAATTTTGGCTACGAGGTTACAACTATTCAAGGCGCTTTAAAGCAAGAAGACCGTGACAAGATAATCAAAGAGTTTAAAGAAGGACTGA
CACAAATTCTAATATCAACTGATGTACTTGCTCGGGGTTTTGACCAGTCACAGGTTAACTTGGTAGTCAATTATGAACTCCCGGTCAGAT
TTAACAATTTGTCAGAGCCAGATTACGAGGTGTACCTTCATCGGGTTGGTAGAGCAGGCCGTTTTGGCCGCAAAGGTAAATTTCATGGAT
CTAATCTCGTGCTCCATTGTTTGTTCTCAATTCTCGCTTCTCAATGTAATTTCATGATATTTTACCTGGAAAAGTAGCTAGTTTCTATCT
TGTTGAATGTGTATGTTAAAGCAATTGATCACATAGCATAATGCACAGGTTCATGCTTTTTCATTAATTGTCAAACTGTCTGGCCATCTG
CAAATGGGATAATGAAAAAAAGAGAGACATATTAAGCCATGAATCTTCGGTCTTGTTTGCTTTGATTCCTGAAGATGTTAGATGATTCAT
TGGGTAGTCATGTGCGGTTGGCCAGCTTTTGATTTCCTTGTGTGTATTTCATTATAAATGTTGTCAGTGTGGGCATATAAAATTTACCTA
AAACATATTTTT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (4)  
mRNA member sequences (6)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (2)