Unigene SGN-U616617

Unigene Basic Information 
Unigene ID: SGN-U616617
Unigene Build: Coffea canephora #3
Date: 2010-04-15
Organism: C.canephora
Alternative ID: none
mRNA sequence: Length: 1320 bp

>SGN-U616617 Coffea canephora #3 (24 members)
ACTCTAGTCTCCACTCCTGCCAGCTTTCTCCTATCCCTTGCCACCCCAAAATCCAAATCCCACACACAACACACAAACACACAAAATACA
CAACAAAATCCAACTCCCACGCACAAAACACACATTTAGGCAAGAAAAGTAGCCACCACAAAGGCTAATAAGATGGAGAACTTCCCAGTA
ATCAACATGAAAAACCTCAATGGTGACAAGAGAGCTTCCACCATGGAGCATATAAAGGATGCTTGTGAAAACTGGGGTTTCTTTGAGTTG
GTGAACCATGGAATCCCACACGAGATGATGGACACAGTTGAAAGATTGACAAAAGGTCATTACAAGAAATGCATGGAGCAAAGGTTCAAG
GAGTTGGTGGCAAGCAAGGCTTTAGAGGGTGTACAAGCTGAGATTACGGATATGGATTGGGAGAGCACATTTTTCTTGCGCCACCTTCCT
GTCTCAAACATTTCACAAGTCCCTGATCTAGATGATGAATACAGGACCATCATGAAGGAGTTTGCTGTAAGATTAGAAAAACTGGCTGAA
GAACTTCTTGATTTACTATGTGAAAATCTTGGTCTTGAGAAGGGCTATTTGAAGAAAGCCTTTTATGGTTCAAAAGGTCCCAATTTTGGC
ACCAAGGTTAGCAACTACCCTCCATGTCCCAAGCCAGAATTGATTAAGGGACTTCGACCACACACTGATGCTGGTGGGATTATCTTGCTT
TTCCAAGATGATAAAGTAAGTGGTCTACAACTCCTCAAGGGTGATCAATGGGTTGATGTCCCTCCAATGAAGCACTCTATTGTGGTCAAC
CTTGGTGACCAACTCGAGGTGATTACCAATGGAAAATACAAAAGTGTGCTCCACAGAGTCATAGCTCAAACAGATGGAAATAGGATGTCA
CTTGCTTCATTCTACAATCCAGGTAATGATGCAGTTATTTATCCAGCACCAGCACTACTGGAAAAAGAAGCAGAAGAAAGAAAAGAAGTC
TACCCAAAATTTGTTTTTGATGACTACATGAAACTCTATGCTGGACTTAAATTCCAGGCCAAAGAGCCAAGATTTGAACTCATGAAGAAC
GTGGAAGCCAATGTTACCATGGGTCCAATTGCAACTGCCTAGACTCATAGGAATAAAACGGTGCTAGGATGTTTTCTTCTCCCTCTTATG
TTTTCTACTTATTATTATTATTATTTTTTTATTGTGGGGGTTGGTGGTTATTCCCAGTCATTTGTTGCTCCAGAGAGGAGGGTCCTTTAT
ACATCTGAGGGACCAAAATTTATTATGTAGTAAGAATTCTAAGACAAAGAAATAAAATAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (7)  
mRNA member sequences (24)  
Alignment image suppressed for unigene with 24 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)