Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U617771

Unigene Basic Information 
Unigene ID: SGN-U617771
Unigene Build: Coffea canephora #3
Date: 2010-04-15
Organism: C.canephora
Alternative ID: none
mRNA sequence: Length: 870 bp

>SGN-U617771 Coffea canephora #3 (18 members)
GCTTTCTTTCTCTCTCTAAATCAGCGCACAGTAAATTTAGCCCAATTTTTTCCCACCCTCTAAATTCGCCTTCCTTTGATTCTCTCTTCT
CTTGTCGTCCATCGATCCGACTGGTGAGGTTTATTTTTGTAGGGATCGGAGGTGGATTAGGGAAATTGGGGGTGATTAATTGAGGAATTT
TGAGGTGAATTATAATTACAAGGATTCGAAGATGTTTTTGTTGGATTGGTTCTACGGAATATTGGCCTCGCTAGGACTGTGGCAAAAGGA
GGCTAAGATCTTGTTTCTGGGCCTCGATAATGCCGGCAAAACCACCTTGCTTCATATGTTGAAAGATGAGAGATTGGTTCAACATCAGCC
AACGCAGTACCCGACGTCTGAGGAGCTGAGTATTGGCCAAATTAAGTTTAAGGCTTTTGACTTGGGAGGCCATCAGATCGCTCGCAGAGT
CTGGAAAGATTATTATGCCAAGGTGGATGCAGTTGTTTATCTCGTGGATGCTTATGACAAAGAAAGGTTTGCAGAATCAAAGAAAGAGCT
GGATGCTCTTCTCTCTGATGAGTCCTTGGCAAATGTCCCTTTCCTTATTCTGGGGAACAAGATAGACATTCCTTATGCAGCTTCTGAGGA
CGAGCTGCGTTACCACATGGGCCTGACAGGCATCACTACTGGAAAGGGCAAGGTAAACTTGGCAGACTCAAATGTCCGTCCCCTTGAGGT
CTTCATGTGCAGCATTGTGCGCAAAATGGGTTATGGAGAAGGCTTCAAATGGATGTCTCAATATATAAAGTAGTGGGCTTTAGTGGGGGG
TGAGAAAGAGAGCTGTTTTTTCTTTTAAAATGTAACTCCTGCCAAAATGGAGTAGAACAT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (6)  
mRNA member sequences (18)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (2)