Unigene SGN-U619517

Unigene Basic Information 
Unigene ID: SGN-U619517
Unigene Build: Coffea canephora #3
Date: 2010-04-15
Organism: C.canephora
Alternative ID: none
mRNA sequence: Length: 1372 bp

>SGN-U619517 Coffea canephora #3 (9 members)
CCGTTAGAAGGGGCCAGACTATTGACTTTTCTCCTAGAGGAACAAATGTGTTAGCTTCTCCAAGCTCCCAGATGGGTGGTTTCCGTCCTA
TGCCTCCTCAGCTCCGTGGCTATGGTGCACAAGATGTTCGGATGGAGGATAGACCTTTTGAAAGCAGGACAATGCCTGTTCTTCCTCAGA
GACCCCTTGGTGATGATTCTATTACTCTTGGGCCTCAAGGTGGTCTTGCACGGGGAATGTCGTTTAGAGGGCAGTCAGCTTCTCCAGGCA
TTCAATTATCTGATGTCCCAAGTACTGGGGACTCTAGGAGAGTGGGACCTGGGCTGAATGGTTACCCTGTTGCAGATCGGACAGCTTATG
CTTCAAGAGAGGATCCAATGCCAAGATACACACCAGACAGGTTTAGTGGTGCATCTTCTTATGACCAATCAAGTACACAAGAACGCAACA
TGGCTTATGGGAATAGAGATGTTTGGAGTACGGATCGTGGTTCTGATAGATCTCTTCCTACATCTCCACCTGGACGAGGTGGTGGTGGTG
CCTTGACACAAAATGTGTCTTCTGACAAAGTTTGGCCTGAAGAACGGTTGAAGGACATGTCCATGTCAGCAATTAAAGAGTTTTACAGTG
CCAAAGATGAGAACGAAGTTGCTTTGTGCATCAAGGATTTGAATAATCCGAGCTTCTATCCCTCGATGATATCTCTGTGGGTTACTGATT
CTTTTGAGAGGAAGGACATGGAGAGGGACCTTTTAGCAAAGCTTCTCATCACTCTTACGAAACATCGAGATGGCATTATAAGTCAAGATC
ATCTCACAAAAGGGTTTGACTCTGTGCTTATGACCTTGGAAGATGCCGTAAATGATGCTCCAAGGGCTGCTGAATTTCTTGGTCGCATCT
TTGCCAAAGTGGTATTGGAGAATGTAATATCGTTTAATGAAGTTGGACGCTTAATATATGAAGGTGGAGAAGAACAAGGACGCCTAGTAG
AAATAGGACTTGCTGCTGAAGTTCTTGGAACCATCTTGGAGATAATTGCATCTGAAAGAGGTGATTCTGTATTGAATGAGATTCGCTCGA
GCTCTAATTTGCGGCTAGAGAACTTCAGGCCTCCAAGTTCTAACAAAACATGGAGACTAGATAAGTTTATTTAGAGGGTACTAGTGATGC
TCGGTGTATCTGGTAGAAGAAATCACTTTAGGTTGCCTCTTTAAGTTTGCAGATATATATATATATATATATAGACACACATTATTGTGG
GCAGATGGGGATTTAATAGGGGTTACCCGGCATGTTTTAATATTGTTTTCTAGAAATAACTGCAATTGCCAAGGTTCAATTGAGCATCCA
ATTCTCGGCCTCTAGTTGCATC


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (5)  
mRNA member sequences (9)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)