Unigene SGN-U632725

Unigene Basic Information 
Unigene ID: SGN-U632725
Unigene Build: Coffee species #1
Date: 2010-04-19
Organism: C.canephora
C.arabica
Alternative ID: none
mRNA sequence: Length: 1334 bp

>SGN-U632725 Coffee species #1 (14 members)
GGCCGGGGGATTCATTCACTCTCTCGCTCTCTCCCATTTTCTTAACTCTGTTTTTATTTTTTGATTTTAACTCTGTATTTTAATTTTCTG
GGTTGGTTTGGGAGGGCAGGGCCGTCCTCGTCTGGTCCTGGTGGACTGGGACTGGGGGAAGGAGTCAGTCTGTGGGAGCTGCTAAGTGCT
AACTACTACCGCTGCTGCCACTGCCACCACCACAAGATAAACTTTACTCAATCTCAAAGTTGGATACTCGGCAAACTAGCTGAACAAGTA
GTGGAGCGAGAGCTCAAGAAGGGAACTCCCAAGTGCTGATCAAAAAATAAGAAACAAACAAGCAAGAATTGGCCCGCCGGAGGAATAGTT
TTGACATTTTGAGGCTTTCAGGCTGCGAGAATGAGCGCGTCCAGGTTCATTAAGTGCGTCACCGTCGGCGACGGAGCTGTGGGTAAAACT
TGCCTACTCATCTCCTACACCAGCAATACCTTTCCCACTGATTATGTGCCGACTGTGTTTGACAATTTCAGTGCAAATGTGGTAGTGGAT
GGGAGCACTGTAAATCTAGGGTTGTGGGATACTGCAGGGCAGGAAGATTACAATAGATTAAGACCCTTGAGCTATCGTGGTGCAGATGTC
TTTATTCTTGCATTTTCTCTTGTTAGCAAGGCCAGTTACGAGAATGTCTCAAAAAAGTGGATTCCTGAATTGAGGCATTATGCTCCTGGA
GTACCAGTAATCCTTGTTGGAACAAAACTTGATCTCCGGGATGATAAGCAGTTTTTTGTAGATCATCCAGGAGCAGTGCCCATCACCACA
GCTCAGGGGGAGGAGCTGAGAAAGCTGATTGGGGCTGCTTCATACATTGAGTGTAGTGCAAAAACGCAACAGAATGTGAAAGGTGTATTT
GATGCCGCCATTAAGGTGGTTCTGCAGCCCCCGAAGCATAAGAAGAAAAAGAAGAGAAAGGGTCAAAAAGGCTGTAGTATATTGTGAGTG
GCAGGAGTAATTTGGAGGAATACATTTTATTGTTGACTGCAGCATTAATCTGATTTCTCTATGGAGCTTTTCCTCATCGTAAGGCAGGCG
CAGCGAGCTACGGTTTATTATTAGTCTCAACTGACTTTAAGCATATCAAAGTCGTTGACCTGCCACTGTCAGTTGCAATGCTGAATGTAT
CTTGCGAATCAAAGATGTCTGTATGGTGGTTTGAACAGTCCCTCTACCTTATGATCCTAAGTACGTATGTATAATGTTGTCGTGTCATAT
ATAACTTGTACTACAAGGGATGGATGCTCTACCTTATGATGATCCTTGATATTTGAAGTGTTCGACCTTGGGCC


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (8)  
mRNA member sequences (14)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (0)None