Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Unigene SGN-U637583

Unigene Basic Information 
Unigene ID: SGN-U637583
Unigene Build: Coffee species #1
Date: 2010-04-19
Organism: C.canephora
C.arabica
Alternative ID: none
mRNA sequence: Length: 1362 bp

>SGN-U637583 Coffee species #1 (23 members)
GGCGCGGGGACGTTCACTCAGCCACCTCCCACGGTGCATCGAGTAACGTAAGGAAGGATTTAATTCATGGGTTTCCACAAAAAACAATTT
TTGATTCGTTGGACGAAAATGACCTCACGTTTGGGATTTATTACCAGAACATCCCAGCTACACTCTTCTTCAAGAGCTTGAGACAGCTCA
AACATATATTTAAGTTTCATTATTACGGATTAAAGTTTAAGTGGCACGCCAGATTAGGGAAGCTTCCGAATTACGTGGTGATTGAGCAGA
GATACTTTGATGTTAACCTAGTGCCGGCTAACGATGATCATCCGTCGCATGACGTGGCAGTGGGGCAGAAATTTGTTAAGGAGGTATACG
AGACCTTGAGGGCTAGTCCTCAGTGGAAAGAAATGGCATTGTTGATTACTTATGATGAGCATGGCGGGTTTTATGATCATGTGCCCACCC
CTGTTGAAGGGGTGCCTAATCCTGATGGGATTATTGGGCCGGACCCCTATTATTTTGCGTTTGATCGATTGGGTGTTCGCGTGCCTACAC
TGTTGATCTCGCCCTGGATTGATAAGGGAGCTGTAATACACGAGCCCAACGGTCCAACTCCACAGTCACAGTTGGAACACTCATCTATTC
CTGCTACCGTAAAGAAACTTTTCAACTTAAAATCAAACTTCTTGACTAAAAGGGATGCATGGGCTGGAACTTTTGAAAATGCCTTCAAGC
TCCGTGAGACTCCACGTGATGATTGTCCAGAGAAACTCCCAGAGGTAAAGCAGAGTTTGAGGCCACGGGGTCCAAGGGAAGATGTTGAAC
TCTCTGAATTTCAACTCGAGTTGATCCAGCTTGCATCACAGCTCAATGGAGATCATGTACTGAACGCATACCCGGATATTGGAAAAGGCA
TGACCGTTGGTGAAGCAAATAGGTACGCCGAGGATGCAGTTGAGAGGTTCCTGGAAGCTGGAAGGGCTGCTCTGAGAGCTGGCGCAAATG
AATCGGCCATTGTCATCATGAAGCCGTCCCTCACCACCAGAACTGCCGCTGTAGACGCTCGTTACCTGGAAACTTTCTAATTGGCCCTGT
GCTGTCTATACATATTTGAATTGATGTATCATATGTATATATTAAGTATTACATTCGGAATTCGTCACGCACGGCAAATTCACCCTATTA
AGCAAATCGCGCCGTTTAATATTGCAATACACTGTATACCTATAGGAATCTCAGGACTTGCAATTGAACGAGTGATTGTTGCGTAGCGCA
AATAGTTGCTGAAATAAATCATTCCACTTTCGGTTGCATTTTTTCACCTTTATCCGTATCAAATTAGCCTCCGCGGGGGGGGGGGGGTTT
CAGCCCTATGCT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (9)  
mRNA member sequences (23)  
Alignment image suppressed for unigene with 23 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (0)None