Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.


This unigene is from an out-of-date build, Lycopersicon Combined #2
It has been split into SGN-U579157, SGN-U579666, SGN-U580902, SGN-U583317, SGN-U592049, and SGN-U593348 in the current build, Tomato 200607 #2
Unigene SGN-U143151

Unigene Basic Information 
Unigene ID: SGN-U143151
Unigene Build: Lycopersicon Combined #2
Date: 2003-08-20
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 143151
mRNA sequence: Length: 1519 bp

>SGN-U143151 Lycopersicon Combined #2 (38 members)
CAGTAGTTACATTGTGCTAATGGCACATAAACCTAATGTATTTCTTTTTCCGAGGTGTATTGAAACTGTGGGAGCCATTTTTGGCTCACG
TTTATGATATTTACTCCTTAATTAAAAAAAAAAAAAAAAAACTCGCTTCTTCTGCTCATCAATTAGCAATTAATCCAAAACCATTATGGC
TGCCAAAAATTCAGAGATGAAGTTTGCTATCTTCTTCGTTGTTCTTTTGACGACCACTTTAGTTGATATGTCTGGAATTTCGAAAATGCA
AGTGATGGCTCTTCGAGACATACCCCCACAAGAAACATTGCTGAAAATGAAGCTACTTCCCACAAATATTTTGGGACTTTGTAACGAACC
TTGCAGCTCAAACTCTGATTGCATCGGAATTACCCTTTGCCAATTTTGTAAGGAGAAGACGGACCAGTATGGTTTAACATACCGTACATG
CAACCTGTTGCCTTGAACAATATCAATGATCTATCGATCGATCTATCTATCTATTTATCTGTCTCTGCGCGTATAGTGTTGTCTGTACCT
TTGGTGTGAAGAATATGAATAAAGGGATACATATATCTAGATATATTCTAGGTAATGTCCTATTGTATTTAAAATTTGTAGCAATGATTG
TTTGAATAAAAACATACCATGAGTGAAATAATTATTCCACATTAAAAAAAAAAAATTCACGTATTTATTTCACTTATGATACGTATTTTT
GTTCCTTTCGCGTAAAAAAAAAAAAAAAAAAAAAACTCGAGACTAGTTCTCTGAGGAATCCTTCTCAATCTTCTACTAACAATCAAGACA
GAGCCGGACCATCAGATTTTCAGTCTTTTTCAGATTCTATGAAGTCTCGGTTTAGTGCAATGTCAATGAGATGCAAAGAATCTTTAACCA
AGAGTTCAAGGGGTTGGAAGGAGAGATTTTTCTCTCGCAACAGTTCAACATCAGACAATGTTCCCGAACCTAGGAATGAAGTGAGGGCAG
CTGTTGCCACTGTATCACACATGATGGACCATCTGGAAACTACAGATAGCAGAACCAGTTCTGCTGAATCAAATATACTGGACACTACTT
TACCTATCAGAGATGCTGAGCAGCATATACCTGAGAGTGATGGTATTCATTCTTTAAATGAGGATAGTAGGCAATCCCCGTGTGCTGCAA
GTGGTTCAAACTGAAGTTTTATATGAGTTGAAGCATTTTCTCTTCAAGGTAGATACTCTTGCCAGCATCGATGATATATGGTGCGCATCT
TACTGGGTGTGGTGAAACATTAATCCTTTGAAGTGCAACACTGAATGTTAAGATATAGAGGGATGGATGTCGTCATTTTGTCCAAACCAT
GTATATGTATGATTATATAGATGTAAATTGACCCATTCTGGGTAGTAGTACTGATGACTTCAACTGTTCTCTTTAATCTTACATGAAACC
CCCCTTCATAATCTTCATAGACATTGCTGGACAGTTAATTGACCAAGGTTTTCTTGGGATTCACTAGCACCAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (7)  
mRNA member sequences (38)  
Alignment image suppressed for unigene with 38 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (2)  
Annotations (manual: 1 | blast: 2 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None