Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.


This unigene is from an out-of-date build, Lycopersicon Combined #2
It has been split into SGN-U577364, SGN-U578734, SGN-U581067, and SGN-U590276 in the current build, Tomato 200607 #2
Unigene SGN-U143224

Unigene Basic Information 
Unigene ID: SGN-U143224
Unigene Build: Lycopersicon Combined #2
Date: 2003-08-20
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 143224
mRNA sequence: Length: 2982 bp

>SGN-U143224 Lycopersicon Combined #2 (111 members)
ATAAAAGGAAGAAGAAGACGAAGATATTTCCCTCTTCTTCTTTGTCAGAATTAAATAAAAATTTCCCCCCAAAAAAAATATCCATATATT
TTTTTTTAAAAAAAATAAAGTGTGTTCATTGGGGAAAAAAAAAAATAAATATGGAGAGAACAAGTATCACTGTTGTGTCTTTGCTAGTTT
GCCTTTCATTTGTGTTGGTTAAAGCTGAAGATCCTTACCTACGTTTTGAGTGGAATGTCACTTATGGAACTATCGCTCCGTTAGGGGTCC
CACAACAAGGGATACTTATAAATGGACAACTACCGGGACCTAGGATAAATTGTACGTCGAATAACAATATAGTTGTAAATGTGTTCAATC
ATTTAGATGAACCGTTGTTGTTAACATGGAACGGTGTTCAACAAAGGAAGAATTCGTGGCAAGATGGTACCCCGGGTACTATGTGTCCGA
TAATGCCAGGTACAAACTTTACGTATAGGTTCCAGGTGAAGGATCAAATCGGTAGCTTCTTCTACTTCCCAACAACAGACTTGCATCGCG
CTGCTGGTGGTTTTGGTGCTATCAATGTTCATAGTCGTGCACTTATCCCAGTACCATTTGAGAACCCTGCGGATGACTATAGTGTGTTCG
TGGGTGATTGGTATAACAAGGGGTACAAGTCATTGAAGAAGATATTGGATGGGGGACGGACAATTGGAAGGCCGGATGGGATTCACATAA
ATGGAAAATCTGAAAAGGTTGGTGAGAAAGTTGCGGAGCCACTATACAAGATGGAGGCTGGTAAGACGTATAGGTATAGATTTTGCAATG
TAGGTATGAGGACATCAGTGAATGTTAGGATCCAAGGACACCCGATGAAGTTGGTGGAAATAGAAGGATCACACACAGTGCAGAACGTAT
ACGAGTCACTTGACCTTCATGTTGGTCAATGCCTATCGGTGTTGGTCACTGCTGATCAAGAGCCAAAGGACTATTACATGATTGTTTCGA
GCAGATTCTTGAAGCAAGCTAAATTGTCCTCTGTGTCTATCATCCGATACGTAAATGGAAAGGGACCAGCATCTTCTGATCTCCCAGCAC
CACCACCAGAAAACACTCAAGGCATTGCCTGGTCCATGAACCAATTCCGCTCCTTCAGATGGAACCTTACTGCTAGTGCTGCCCGTCCCA
ACCCTCAGGGATCATACCACTATGGACAGATCAACATCACTCGCACTTTCAAGATTGTCAACTCAAGGAGTGAAGTTGATGGAAAGCTTA
GATACGCGTTGAATGGTATCTCCCACACTGATTCAGAAACCCCATTCAAGCTAGCTGAATACTTTGGAGCTACCGATAAGGTCTTCAAGT
ATGATCTCATGGCTGACGAACCATCAACACCAGACGACAAGGTAACCATTGCCTCAAATATCAAGAATGCAACATTCCGTAACTTTGTTG
AGATCATCTTTGAGAACCATGAGAAGACCATCCAAACCTATCACTTGGATGGTTATTCCTTCTTCGCTGTTGCTGTTGAGCCAGGCAAGT
GGACTCCCGAGAAAAGAAAGAACTACAACTTAGTCGATGCCATCAACAGACACAGCATCCAAGTCTACCCTAACTCATGGGCTGCCGTTA
TGACCACACTTGACAATGCAGGACTATGGAGCTTGAGATCAGAAATGTGGGAGAGGTTCTACTTGGGACAACAACTATACTTCAGTGTTC
TCTCACCAGCTCGCTCGTTGAGAGATGAGTACAACCTCCCTGACAACCACCCTCTTTGCGGTATTGTTAAGACTATGCCAATGCCTTCTC
CATACAAGGCATAGATCGTCATACATTCGAGGGGGGATCATAACAACAACAACATACCTTGATTTTTTCCCCTTTCTCAAATCATGTATT
CTTTCCATTTACATTCTTATAATGAAAACTTAAGTCAAGGCTTTTCCCCCCTCCACATAAGTGCCAAGAAATTGTAATTCGAGATGATCG
ATAAATCAAAGAGCTGCATTTTATGTCTGTTGCAAAAAAAAAAAAAAAAAAAAAATGCTTTCTAACTTCGATTTTGCAACCTGCAGAAAG
AAACAAGGAAAGGCCAAATATATATATATTTTTAGAGAAAAAGGAGGAAGAAAAAATGGGAAAATCAATAATTATCTTTATTGCTAGTGC
TATTTGCTTGTTCTCCCTATTAGGGATTACTCAAGCCAATGAAGAATCTGATAAGTATCAATTTATTCTAGAAGGAATAGTGTATTGTGA
TCCTTGTCGTTCAATATTCAAAACCAATCTTAGTGAGCCAGTTGTAGATGCGAGGGTGGGGATGCAATGCCGACACCCTGAAACTGAACG
AGTCACAATAACCGTGACAGCCTCGACTAACTCCACTGGATATTACCACATGTTGATTGAAGGTGATCACGAGAACGAAATCTGCGAGAC
ATATTTGATAAAAAGTCCAAAAGAAGATTGCAGTGAGATCCCAACTGAAGGACATACCAGGGAATTATCAAGAGTTACACTGACTAGCAA
AAATGGCATTGCTGGAAAGAATCGTGAATCCAACCCACTCTTTTTCTTGACCAAAAAAGTAGCACCAGAATGTCAACAAGAATTCAAGGA
AATGGAATATCTCCCTGAACTTAAAGATATTAACCAGGCCTAAACGATTTTAAATTGAATTACAATAACATTAAGAGTCTATTTGGATCG
ACTTTTGACTTCATAGCTAAAATCTCTAACTGATGACTTTTAGCTTATTTTTATCATATAGTTTACAGTCAAATTTTAATAAACTCTAAA
AAAATAATTAAAATAAGTCAATTCAAACAGATTCTAAATATTGTCTTACATTTAATTTATTTGTTCTGTCATTAATTTTGCATCTATATA
TATACAAACTTTAATTAAGGACGATATGGTCATTTAATCATTTTTATGTAATTTTGTGTTGGTTTGAATTTTGATTTTGAGGCTTGAGAG
GTTAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (4)  
mRNA member sequences (111)  
Alignment image suppressed for unigene with 111 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None