This unigene is from an out-of-date build, Lycopersicon Combined #2
It has been split into SGN-U577171, SGN-U578448, SGN-U580097, SGN-U580403, SGN-U580508, SGN-U592268, SGN-U593193, and SGN-U593730 in the current build, Tomato 200607 #2
Unigene SGN-U143387

Unigene Basic Information 
Unigene ID: SGN-U143387
Unigene Build: Lycopersicon Combined #2
Date: 2003-08-20
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 143387
mRNA sequence: Length: 1637 bp

>SGN-U143387 Lycopersicon Combined #2 (380 members)
ATATTTTAAAAAGGGACTAAACTTAGAAGAGAAGTTTGTTTGAAACTACTTTTGTCTCTTTCTTGTTCCCATTTCTCTCTTAGATTTCAA
AAAGTGAACTACTTTATCTCTTTCTTTGTTCACATTTTATTTTATTCTATTATAAATATGGCATCCTCATATTGAGATTTTTAGAAATTA
TTCTAATCATTCACAGTGCAAAAGAAGATGGAAAGCCCTAGAGTTGAGGAGAGTTATGACAAAATGAGTGAATTAAAAGCGTTTGATGAT
ACTAAGGCCGGTGTTAAAGGACTTGTTGATTCTGGAATTACTAAAGTACCTCAAATATTCGTTCTACCGCCAAAAGACAGGGCTAAAAAA
TGTGAAACACATTTCGTTTTTCCAGTGATAGACCTTCAAGGTATCGATGAGGATCCGATTAAGCATAAGGAGATAGTGGACAAAGTTCGA
GATGCATCGGAGAAATGGGGTTTTTTCCAAGTGGTTAATCATGGGATTCCAACATCCGTCTTGGACAGAACGTTGCAAGGAACACGACAG
TTCTTTGAGCAAGATAACGAGGTTAAGAAACAGTATTACACTCGAGATACTGCGAAAAAAGTGGTTTATACTAGCAATCTTGATTTGTAT
AAATCTTCTGTTCCAGCTGCAAGTTGGAGAGACACGATTTTCTGTTACATGGCTCCGAATCCTCCCAGTCTACAAGAATTTCCAACTCCA
TGCGGGGAGTCATTAATAGACTTCTCCAAGGATGTGAAGAAACTGGGATTCACTTTACTTGAATTATTGTCTGAAGGTCTCGGTCTCGAT
CGTAGTTATCTCAAAGATTATATGGATTGTTTTCATCTTTTCTGTTCTTGCAACTACTACCCACCATGTCCTCAGCCAGAACTCACCATG
GGCACCATTCAACATACCGATATTGGTTTTGTAACGATCCTTCTACAAGATGATATGGGAGGGCTCCAAGTTCTTCACCAGAATCATTGG
GTTGATGTTCCTCCTACACCCGGTTCTCTAGTGGTGAATATTGGAGATTTTCTGCAGCTCTTGTCAAATGACAAGTACTTAAGTGTCGAG
CACAGAGCAATCTCAAACAATGTTGGATCAAGAATGTCAATCACGTGCTTCTTCGGTGAAAGTCCATATCAATCTTCCAAGCTTTATGGA
CCGATAACTGAATTGTTATCAGAAGATAATCCTCCAAAATATCGCGCAACCACAGTGAAAGACCACACTAGTTACCTCCATAACAGAGGC
CTAGATGGAACTTCTGCATTGTCCCGTTACAAGATCTAAGAATAAGAATAATAATGTTATCTATTATTACTATTTATACTTCTGCAGATT
GTACCTTTGAATTTGAAGCAAATGTTTGAGTTAAATACTTTCACGTTTCTAAGCAATGTAATATAATTTATAAAGTATGTGCATAAAAAA
AAATGTTGTTTAAAACATTAAATAATATTACATAAATATAAACACCATAATATAAGGATGTTTAGCATTGTGGGAAAAAAAAAAAAATTG
CTGGTGCACACTAAGAAAACCTCGCAGAAAAGTCATTCAATTATTTGACTTACGAAATCACTCTTCACTATTGTCATTACAGGTTCGACA
GCTACGGTAAACAGGGA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (11)  
mRNA member sequences (380)  
Alignment image suppressed for unigene with 380 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (23)  
Annotations (manual: 4 | blast: 2 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None