Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.


This unigene is from an out-of-date build, Lycopersicon Combined #2
It has been split into SGN-U578218 and SGN-U592075 in the current build, Tomato 200607 #2
Unigene SGN-U143655

Unigene Basic Information 
Unigene ID: SGN-U143655
Unigene Build: Lycopersicon Combined #2
Date: 2003-08-20
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 143655
mRNA sequence: Length: 974 bp

>SGN-U143655 Lycopersicon Combined #2 (102 members)
TTTCTTTCAAAATTAAAGTATTGTTACTCTGCTATTGGCTCAAAACCTCTGCAATCTCCGTCTCCTTCAATTTCAACTCAAGCAAATCCA
CCTCTTTCACTAGTTTCATCACTTTCAGATCAGGGTTTGGAGTTGAAGGTACGGGGGGCTAATTGATGGCGTCGAAGAGGATATTGAAGG
AGCTCAAGGATCTGCAGAAGGATCCCCCCACATCATGCAGTGCTGGTCCAGTGGCAGAGGATATGTTCCATTGGCAAGCAACAATCATGG
GGCCTACCGATAGCCCTTATGCTGGAGGTGTATTTTTGGTTTCAATTCATTTCCCTCCAGATTATCCTTTTAAGCCTCCAAAGGTTGCCT
TCAGAACTAAGGTTTTCCATCCCAACATCAACAGCAATGGAAGTATTTGTCTGGATATTCTTAAGGAGCAGTGGAGTCCAGCATTAACCA
TATCCAAGGTCCTGCTGTCCATCTGCTCTCTGTTGACAGACCCAAACCCAGATGATCCTCTTGTACCTGAAATTGCTCACATGTACAAGA
CTGACAGGGCCAAATACGAAACCACTGCTCGTAGCTGGACTCAGAAATATGCAATGGGATGATGCGCAAAATTGTCTCCAGGCATGTCTG
GGACTTTTGTAACAGCAATGTCTTATTGTGCTTGGGGTGAATGAATAAATTCCGTGAAAGAACTTAGTTACTTCTTAATCTCCCTTCATG
AGGGTTGTTAAGGGAACAGCTGTTTTCAATTTGTGAATATTTATTTGATGACTAGTAAGGGAGAAACTGCAATGTAATTCTACTTTGTTT
GCCAGTTTGACATGCAACTTTCCCCAAATTTGTCTGACAAATATAGTTTACATCTTTGAATTCTGGGATTGATTTACAAATTATCAAACA
CTAGTTTTTCATCATGTTCTATTGTTGAAAATGGAAATGATGACAAGTAANAAAAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (20)  
mRNA member sequences (102)  
Alignment image suppressed for unigene with 102 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (2)  
Annotations (manual: 3 | blast: 2 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None