Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.


This unigene is from an out-of-date build, Lycopersicon Combined #2
It has been split into SGN-U579783 and SGN-U581187 in the current build, Tomato 200607 #2
Unigene SGN-U143715

Unigene Basic Information 
Unigene ID: SGN-U143715
Unigene Build: Lycopersicon Combined #2
Date: 2003-08-20
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 143715
mRNA sequence: Length: 889 bp

>SGN-U143715 Lycopersicon Combined #2 (94 members)
AAAAAAAAAGTGATATATTCCTCAACCCAATTTCATCTACTAGTTTCGCGTAAAGAGTCAGCAGCTTTTCCGATTTTCTGATCAGATTCA
GATTTGTTTGGATTTTGATGGCTTCGAAACGAATATTGAAGGAGCTGAAGGATCTCCAGAAGGATCCTCCTACTTCATGCAGCGCTGGCC
CTGTTGGAGAGGACATGTTTCACTGGCAGGCTACAATAATGGGGCCCTCTGATAGCCCTTATGCTGGGGGTGTTTTTTTGGTCACGATCC
ATTTTCCTCCGGATTATCCATTCAAGCCTCCTAAGGTTGCTTTTAGGACAAAAGTTTTCCATCCAAATATCAATAGCAATGGGAGTATAT
GCTTGGACATACTGAAGGAGCAGTGGAGCCCTGCATTAACTATTTCCAAGGTTTTGCTTTCAATTTGCTCACTTTTGACGGACCCAAACC
CTGACGACCCCTTGGTTCCTGAGATTGCTCACATGTACAAGACTGACAAGTCCAAATACGAAGGAACCGCCAGGAGTTGGACCCAGAAGT
ATGCCATGGGTTAAAAAATTTAACCCTATGATGGCTTGAACTGATATAAACAAAAACAAATTTCAAATGTTTTATCTTCTCTATTCTCCA
TTAACAATGTGTAGAATAGCATTAGGCGTTGCTTCTCTACAGGAAGAACGATAATGCTTTGAATTTGTTTATGTATGAATACTAATATTT
GAACTTTGAACATGTGTGGGAAGCGTATGTATCTGCTTTTTGACTGTTTCTGTTGGTTTGACGATCAATTTGTGTAATTAATTCCATACT
TCAAAAGCCTTTTGTAAAAAAAAAAAGTGTTTATTAATACGGATAACTATAGTTCAACCTGGAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (21)  
mRNA member sequences (94)  
Alignment image suppressed for unigene with 94 aligned sequences.
[Show Image]
Markers Information (1)  
Expression Data (11)  
Annotations (manual: 5 | blast: 2 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None