Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC


This unigene is from an out-of-date build, Lycopersicon Combined #2
It has been superseded by SGN-U578295 in the current build, Tomato 200607 #2
Unigene SGN-U144240

Unigene Basic Information 
Unigene ID: SGN-U144240
Unigene Build: Lycopersicon Combined #2
Date: 2003-08-20
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 144240
mRNA sequence: Length: 1284 bp

>SGN-U144240 Lycopersicon Combined #2 (54 members)
CAAAAAGGGAGAGAATAGAGCAAAATCTCTCTCTGTTTTCACTACAAAAAATCTTTGATTTCAATTTGAGAGAGATCGGAAATGGCTTCT
TCCAAAGAACGTGAGAACTTCGTCTACGTCGCTAAGCTCGCTGAGCAAGCCGAACGCTACGATGAAATGGTTGAAGCGATGAAAAATGTC
GCAAACATGGATGTTGAATTGACTGTGGAGGAAAGGAATCTTCTTTCTGTTGGTTATAAGAATGTGGTAGGTTCTAGGAGAGCATCTTGG
AGGATCTTGTCCTCTATTGAGCAGAAGGAAGAATCTAGAGGAAACGAGCAAAATGTCAAGCGAATCAAGGAGTACCTGCAAAAGGTGGAG
TCGGAGCTCACCAACATTTGCAATGATATTATGGTGGTCATTGATCAGCATCTAATTCCGTCATGCTCTGCAGGCGAATCAACTGTGTTT
TACCACAAGATGAAGGGAGACTATTATCGTTATCTTGCAGAATTTAAAGCTGGCAATGACAAGAAGGAGGTTGCTGAGCTTTCATTGAAA
GCATATCAGGCAGCTACAACTGCTGCGGAGGCGGAATTAGCACCCACTCATCCCATTCGTCTGGGACTGGCTTTAAATTTCTCTGTTTTC
TACTATGAGATCATGAATTCACCTGAAAGGGCATGCCATCTTGCAAAACAGGCCTTCGATGAAGCAATATCTGAGCTGGATAGCCTGAAT
GAGGATTCCTACAAAGACAGCACCTTGATTATGCAACTTCTAAGGGACAACCTCACCTTGTGGACTTCTGATCTTCCAGAGGATGCTGAA
GATGCCCAAAAGGGAGATGCCACAAACAAAGCTGGTGGAGGTGAAGATGCAGAGTGAATGGGCCTAATAGTTAGAACTACTATGTGTATT
TGGAGGTGTGACGACAAGGATACGCCAAGGGGGATGTTAGTTTGTTAAGTCTTAGTAGATACTTCTATTATGGGTCTGTCGTGTCAGATT
CTTCACTTGTTAATTGGTTGTCTGCAACTCAGTGTGTAATTTGTATCCCTGTGCTATTTCCGTTCTCCGTATAGTGAGTTGTTTCAGTCT
TTAGATAATTGCTGGTCTATAGGTGGTTTTATTTTTCAGATGACTGCCGCAGCCAAATGGAGGATATCAGCTATTTGCTTGTCCTCTCAC
CCTTATTATCTCAATATCACTAAATTTCCATTAAAAAAAAAAAAAATAAAACAAACTAAATAGAAAATGGCAAAAAAAAAAGCAAAAAAA
ATTTAGATAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (18)  
mRNA member sequences (54)  
Alignment image suppressed for unigene with 54 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (3)  
Annotations (manual: 2 | blast: 2 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None