This unigene is from an out-of-date build, Lycopersicon Combined #2
It has been split into SGN-U584734, SGN-U584740, and SGN-U584745 in the current build, Tomato 200607 #2
Unigene SGN-U146100

Unigene Basic Information 
Unigene ID: SGN-U146100
Unigene Build: Lycopersicon Combined #2
Date: 2003-08-20
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 146100
mRNA sequence: Length: 1254 bp

>SGN-U146100 Lycopersicon Combined #2 (17 members)
CCCGCCTCTCTCTCTTTCCCTCATCTCTTCTCCCCTCGCCCCGCTTTCCTCTTCTCCTCCTCCGAACGGATCACCGGCGAGCAGCAGCCC
CGGCGACTCCTCTCTCTCCCTCTCGTCTTCCTCTTCTCCTCTTCCCTAGACCCCTCTCTCTTTTCCCATCCTCTCTTCTTTCAGCGAACT
CCAGGCTGCCAGCAGCTCCAACCAGCGACAGCAAGCCTGCAGCTCGGCTAGAGGGCGATAGCAACAACACCAACTGCTCAAGCTGAGGCT
CAAAATCCTGTGATTTCGTACCAAACGGATCTCCTCAGATCCGTCCAGGGAAGAGTCCATATATCTTGTTGTAGTTACAACATGGGGATT
GGCCATGGTGTTGACTCCCTCATTGTTGTATTGCTGCTGAGTTCAATGGTTTCCACTTGTGTTGCTTACCGCCCCGGTGACATCGTTCCA
ATGAGCAAAATGGGTCAATACCACTCTTCGAGGACTGTTTGGCATGATATGATTGGAAAACATTGTCCCATTTTCGGGGTTAATCGGGAG
GTGTTGATACCGATTCCAAAACCAACTGGTTTTACTGGAGCTGATCCTTACAAGATATCATTCCAAGTTGGAAGAGAAAAATATCACGTG
CCATGGTTGTTTGTGATTAATCGGAAGAGTTCTGAGGTTCCAATGATTGATGTGCATTTGAGGTATTCTGGAGGTGATTTGCTTGGTGTT
ACTGCTAAGGTCATTGATATGCCTCATCACTATATTGAACTTCATCCTGATATAGGCGAACACTTTTGGGATCCTCAACACTGGCCAAAG
CACGTGCTTGCTAGATATACATGGGAAGAGCAGTCGGAGATAGATGTGGCGTCGGGATTTTATGTTCTCTTTGGATCAGGAGTAGTGCTT
TCCTTCATCCTGGCTGTCTACACTTTGCAGTCATCTCGAGATAAGTTGGAAAAGTTTGTAAGGGAGACTGTTGCTGAGACCAGCATCCCT
GGCGTAGTAGTGGCAAAAGTTGAATGATAGAAGTTTTAGTTATAGATAACATTCCGATTTGAGTTTAGATGATGGAACGATCAGGTGTAC
AAGTTTACGACATTTGTTAGGGGAAAAATTATATAGAAGATAGATTCTGGAAGTAATGCTTGAGTTTCCCTTAGCTGTATTTGTTTTGCC
AGATTTTTGATATACACATTTCATCACCAAAAGGGTGGCAGAAAAGCATTAGTTATACTTTATTCTAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (9)  
mRNA member sequences (17)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (4)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None