Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC


This unigene is from an out-of-date build, Lycopersicon Combined #2
It has been split into SGN-U577526 and SGN-U577601 in the current build, Tomato 200607 #2
Unigene SGN-U146198

Unigene Basic Information 
Unigene ID: SGN-U146198
Unigene Build: Lycopersicon Combined #2
Date: 2003-08-20
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 146198
mRNA sequence: Length: 1862 bp

>SGN-U146198 Lycopersicon Combined #2 (18 members)
TCCTCTAAGACAGAATTTCCACAAAAAATGGTGTGTTGTACAAAATTCACAATAGCCTTTCAAAAAAATCCAATCTTTTTTAGTATATTT
TTTTCAATTTTTTTCTATTTGTACACAAACATGTGTATGTGTCACAAAAATCAGTAAGCTATAAGGGGGGTTGTATCAATTATAAGTTTA
AATTATTATGAAATTATGAGGATTTACATGATTTGATTGTGACCCTTTTCAAATCTTTGACTCTTGTTACCCTTTAGATTTGTATACTTG
TAAAGAGAAACAAACAAATGGTTTTGTTTTCTCAGATTTACTGTTGAAAAAACAAGAGCCTGTTTTGGTGGACACGAAAATCAAGGAGAA
AGCTTTTAAGGATATTTGGTGCATCTCAACCACCCACTCTTACCCTTTTGTTAAGACCCTTTCATTTTCTGTTCTTGGTTTTTGTCTTTG
TTTTCCTTTTTTTTTTTTTTTTTTTTTTGATGAAGCCTATCAAGAAGACCCAATTATTGGTTGCTTTTGTTGAGAATGGGATGAGTTAAT
CTGGCTTTCAACCACAAAATCTTATCTTGGATCAGGGCCGTCAAGAGAGCTAGAAGATCAGATTTGTGGAGGATATATATTGTTGTCAAC
ACATAGTAGTTTATATAGATACCATGGCTCCCGGAGGCAGTAACTACCAGGATATTGGTGATTCCCGCAGTGCATATTCTGACTATGGTA
TTGCACCAGAAAGTGCTGAGTTCAAAAACTCCCCCTTTAGAAAAGCTGCAGCTGTTATTGGTGGGAAGAATGGAGTTGGATCTAATAGTG
CTGTTCATGAGCTACTTGAATGCCCTGTTTGTATGAATCCAATGTATCCACCAATTCACCAGTGTCCAAACGGCCACACGTTATGCGTGA
AGTGCAAGTCAAAAGTACATGTGTGTCCAATTTGCCGCCATGAGCTTGGAAACATAAGATGTTTAGCACTGGAAAAAATTGCTGAGTCAC
TAGAATTGCCGTGCCGATACCAAATTTATGGCTGTCAAGATATATTCACTTATCATACTAGGCTTCGTCATGAGCAGAACTGCAGATTTC
GACCATACAATTGCCCATATGCAGGATCTGAATGCGCTGTTACCGGTGATATTCAGTACCTCGTTGCACACCTAAAAGATGATCACAAAG
TTGATATGCATGATGGCTGTACCTTCAATCATCGTTATGTCAAATCTAATCCTCAAGAAGTTGAGAATGCTACATGGATGTTGACGGTTT
TTAACTGTTTCGGTCACCAGTTCTGCCTGCACTTTGAGGCTTTCAATCTTGGATTGGCACCGGTATACATGGCATTCCTTCGTTTTATGG
GTGATGATGATGATGCGAAAAGATTTAGCTATAGTCTTGAAGTAGGTGGATTTGGCAGAAAGTTAACATGGCAGGGAGTACCGAGGAGCA
TCCGTGATAGTCATAAAACTGTCCGAGACAGTTTAGACGGGCTGATTATTCAAAGGAGCATGGCACTCTTCTTCTCTGGTGGTGACAGGA
AGGAGCTGAAGCTAAAGGTAGCTGGGCGTATTTGGCGAGAGCCATTGTAAACTAGATATATGCATCTTCCTTCATCGTGGGGATGCCCTG
AAAGTATAGTTAGTTATCGCTAAATTGGTTGGTGGCTTAATTTTTTGTAAATGGTTCTATACAGTTTCTGGTTTTTCGGATCGATCGTAT
CGATTGTAGTTTAGCTCAACTGTGGATCATGTATCTAAAGTTGTGAGGCATTTTAAGCTTTTCTATGACCAGCCATATGATAATCTATCT
GGTTATTAGTCTCTTTCTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (11)  
mRNA member sequences (18)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (4)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None