This unigene is from an out-of-date build, Lycopersicon Combined #2
It has been split into SGN-U577624 and SGN-U580904 in the current build, Tomato 200607 #2
Unigene SGN-U148208

Unigene Basic Information 
Unigene ID: SGN-U148208
Unigene Build: Lycopersicon Combined #2
Date: 2003-08-20
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 148208
mRNA sequence: Length: 1573 bp

>SGN-U148208 Lycopersicon Combined #2 (10 members)
TCTTCTGGAACTCTCTCTTCGTTCCTCTCACAGTCTCACTCACTCATTGAGTCTCTCCATGGGCTCATCTTCTACATTCTCTCTGTGTTC
TCATCCGACGGTGAATTTTGAATTTAATGGTAGAAAAGTTGGATACGGATTGCAGAAATCGTTGAGTAGTTCATCCAGTTATTGTTTGAT
TCATATTTCGCCGATTAGTATAAGTAGTAGAAGAAGAAAATGCATGCAATTGAGACGTGTAACTGTTAGAGCTGCTTCGTCGTCTAGTAC
TGGTTCGAGACGTTCGATGAATACTCGGAGAGTTTACAAGGAATCACAAGCTCAAACGTCAGCATTACCTGTTGACAGAATTGTTTCTTT
TGTTGTGCCCGCTGGTGCTTTTGTGGTTATCTCTTTTGTTGACGTTTTGTGGAAGCTGGTGGAGAAAATTCTTCTACCCAAACCAGCCAA
TACTACATCAGAAGAAAGCAAGTCTACTCAGGGATTGAAGTGGTCCATTGCCGCTGGGACAAACTTGTTGCCTGGTTTTGGTGCAAAGAT
TGAAAGAGAATCCAAGCTGAGGCTTAATGACTTTGCTAAAGAGCTTAGATCTTTCAGCATTGTTGACATGTCAGGTCGTAACTTTGGAGA
CGAGGGGCTCTTTTTCCTAGCAGAGAGTTTAGCATATAATCAGACAGCTGAGGAAGTAAACTTTGCTGCTAATGGAATAACTGCAGATGG
ATTGAAGGCCTTTGATGGTATATTGCAATCAAATATTGCTCTAAAGACTCTTAACCTATCTGGAAATGCTATTGGGGATGAAGGAGCCAA
GTGTCTATGTGATATACTGGCAAATAACTCTGGTATTCAAAAGCTCCAGTTGAACAGCACTGGCTTAGGAGATGAGGGAGCCAAAGCCAT
CGGTGAAATGCTGAAAAAAAATTCAACCTTGCGTGTTCTTGAACTAAACAATAATCTGATTGACTATTCTGGATTTTCAGGTCTTGCTGG
ATCACTTCTTGAGAATAAAACTTTACAATCCTTGCATCTCAACGGCAATTATGGTGGTGCTTTAGGGGCTGCAGCACTGGCTAAAGGCTT
GGAGAGCAATAAGTCCTTGAGGGAACTTTATTTGCAGGGGAACTCTGTTGGCGATGAAGGAGTACGGGCATTAATCTCTGGCCTGTCTTT
GCGTAAAGGGAAACTTGTCTTACTTGACCTTGCCAACAATTCAATTACTGCAAGAGGAGCATTTCATGTTGCCGAATACGTCAAAAAAAG
CAAAAGCTTACTGTGGTTGAATCTCTATATGAATGACATTAAAGATGAGGTAATTGAACCACTTAAAACTTTCACAGTTTTCTTCCTTTA
TTATGTAAAAGACTCTTCTCAGCTAACCAAGCTTTTCACTTGAGAAACCAAACGTGTCCATTTTTGCATAGACGATGTATTTATTTTATC
CACAGTTATATTTGAAGGATAAAGTTTAACCTGTCCCCATAAATAAGGTATTTGATTTCTTACGTCGCAGATCCAGACTCGATCTCTTGA
TATGCATTGACTTTCCCTTCTTTTTTTCTCCATTTACATCATA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (7)  
mRNA member sequences (10)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (1)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None