Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.


This unigene is from an out-of-date build, Lycopersicon Combined #2
It has been superseded by SGN-U565367 in the current build, Tomato 200607 #2
Unigene SGN-U152758

Unigene Basic Information 
Unigene ID: SGN-U152758
Unigene Build: Lycopersicon Combined #2
Date: 2003-08-20
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 152758
mRNA sequence: Length: 1218 bp

>SGN-U152758 Lycopersicon Combined #2 (4 members)
CATACCTTAGCAGCACGCTTCCATCTATTCATACACCCTTTGTGCTTGTTGCCCCCATTTCTGCCGCTCCAAATGGTGCCTGCTCAATCT
TTGCCACCACACCCAGCTCTTCCCTCTTAGACTTTATCGATCCTAATTGAGCCCTCCTTTTTTCAATCAATTATCTAATTTAGTCCTACT
GCGATTTTGTATGATTCACAATTTTAATGCTGCTGAAAGCAATTATATAAAAGCTGAAACATTTTGCACTGATGTTCAAAACTAACAATG
TTACCGCCAGGCTTTTTGAGCGCCAGATTTGCACCCCTGCTCCTGGCACCAGCATCCATCGTGCCAGAAGATTTTATGAGAACGTTGTAC
CAAGTTATACCATATACGATGTTGAATGTCCCGACCATTCATTTCGCAAGTTCACGGATGACGGTCTATATTTTGTAAGTTTCAGCCGAA
ACCATCAGGATCTGGTTGTTTATAGACCAACATGGCTGACATTTTCCTGCAAAGAAGAAGATTGTGATACTCATGATCTTCCTTTGAAAG
CTAGAAAGTTTGAGAGCTTCTTCACGCAGTTGTACAGTGTTACTCTTGCTTCTAGTGGGGAACTTATATGCAAAGATTTCTTTCTCTATA
TGGAGAGCAACCAATTTGGACTCTTTGCAACTTCAACTGCACAAATTCATGATGCACCTCCTACTGGAGGGGCAATTCAGGGAGTCCCTT
CAGTTGAAAAAATAACTTTCCACCTTTTGAGGTTGGTGGATGGAGCTATACTTGACGAAAGGGTTTTCCACAATGATTATGTTAATTTGG
CACATAGCATTGGTGCTTTCTTGTATGATGATTTGCTTGCTATAGTGTCTCTTCGTTATCAAAGAATACACATCCTTCAGATCAGAGATT
CTGGAGATCTTGTTGATGTACGAGCAATTGGGGAATTCTGCCGTGAAGATGATGAACTTTTTCTCAATTCCAATTCCCAGGTGCTTGTAA
ATCATGTTGGAAATGGTTTTCATCATAGTCTGCCTCAATCAGAAACTTCTTTCCTGAGCGGTATAAAGCAACGGCTGCTTTCATATATAT
TTCGAGGTATATGGAATGAAGCTGACCAAACCATGAGAGTGCAGTGCCTGAAGAAGAAGTTTTACTTCCACTTTCAAGATTACATTGACT
TGATTATCTGGAAGGTGCAGCTGTTGGACCGACATCACCTGTTGATCA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (4)  
mRNA member sequences (4)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (1)  
Annotations (manual: 2 | blast: 2 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None